Description :
From Genome Similarity Track
Location :
contig_77:2315- 3667
Transcript NameFunction/comments
g11897.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
1352 bases(100 bases per row)
AGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTACGCGACGCTGCGCATGATCATCGCGATCGCCAAGTACTT
CGGCTGGCCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGGTGGTGTTCTGCGTGATTCCCGAAGGCGTCGAACTGGAT
GGTGGCTTTGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCA
GCTTCCAAGTGTCGGCCTTCGATCCGTGCCTGTACATCAAGGTGGTGGACGGTCAGTGCGTGCTCGTGCTGGTGTACGTGGACGACGTGCTGATTACCGG
GAGTTCGCCCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTG
GTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAACGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTC
CGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGC
CACGCGCCCGGACATCGCGTACGCTGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGAGGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTAC
CTGCAAGGCACCAAGACGCATGGCATCTGCTTCAAGCCGGACGACAAGATCGACTTTCGTGGCTACTCGGACGCGGACTGGGCCGGCGACCTCGCCGACC
GCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAGTCAAGTGTGTCGCTGTCTACGAGCGAAGCGGA
GTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGATTCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATG
ATCCGTGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGACG
AAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCATGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCT
GACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGG