Description :
From Genome Similarity Track
Location :
Scaffold_142:23147- 25631
Sequence
2484 bases(100 bases per row)
TGCGGCATACTGCGATAGAGAAACTCCGATTATGGCCAGCACATGAATTTGTACGTCGGAAGCGGGACTGAAACCAGAGTGCTGATCGAATAGCGATTGA
AACTTTACAGCAAGGGAAAGTGACATTTTGGTATCTGACCAGGAGTAAATAAATAATATCATGCTTAACCGTTTGAATGCGTTTCTGATACCGAGACACG
TCCATTTTCCAGTCAAGGCGGCTTCGATCACTTGGTCAGCTGCGCGAAGACGTTTTCCCCTTGCAGTTCTGCAAGAAGAGATCGTACAGCGGCTCCGGAT
CGAGCGCATAAGTCTAGCGAAAGCTGAAGAGACTTGGATATCTGACTTGATAACGTATCTTATCGGAAACATAGCCAGGCTAAATGTTAGATGAGCGAAG
GTCTGCGCCCTAATCGCACCAGTCTACAAAGTCGACCAAAGTGGATTGTAATTTTTCTGTCCTAGAGAAGCGACAAAAGTGAAGATCCGGGGGAGTCGGT
TCGTCTGGTAATTCCCGAGTTATTGCAGCGGGATTTCTTACATCATTACCACACTAGTTTGGAGATAGGACGCCAAGGAGTATGCCGCGCATATTAACGG
ATTAGGACGAACTTCCATTGGCGAGGATTTTACCGGAGTGTGCAGGGCTACGTAGGCAAATGCGTCAACTGTAAAACCGAAAAGTGTCGCTTTTATGATT
AGGACGGGTTGCCGGGAAACTTACAAGCGACTTACCCATTTCCAATTCTGACCATGGGTCACATTTCATCTCTGCCGCGATCTTTCAAGGGGGATACAGA
GTTGTTACTGTGGGTCAATCTGTACCAGCGCTATGTGATCTCAAAGGAGCGTTCGTCCCGGACTGCACAGACGATTGCAGAGAGAAAATAAGTGTGTGTA
TTTCAAAGACTCGGTGCGGTTAAGGCGATTCGCCATGACCGGGAACCTGGACATATGCCCGATTTCTTCCGGTAATTTTACAAGATTGCGGGACGAAAGC
AACTAGCTAGTATGGCGTATCGGCCTCAAGCGAACGGAATTGCTGAGCACAGAGAGCATGGTTTAAATCGAAGCTATCGATTAAATTATACGTCACTGAT
GAAAATCAGAGGGACTGGGAGGAATATACAGAGCGATTAACTTATGCGATCAATACCGCACAAGATCGAGTCCGCGGAGAAACACCGTTTTACTTGAATC
ATGGATGGTATCCGCGATCGACGCTAGAAGCGACCCTGCCATTAGGAAGTATTAAACCCTGCGATCGCAACCTCAAAAGATAGCGGTATTTTGAACAGCG
TCAATATAAACGAGCAAGAGCGACCGTAAGTTGTCGGATTAAGATCGCGACTTAAGACCGAGCTGATCTCCATAATGAAGACCACAATCTGCTGGGAATC
GATCGCGGATCACAAGTGTGGCTTTATTACGAACGCGTCAACGATGGGTTCGCTCGAAAGTTAGCTAATATGTCGCATGGACCATTTCGGGTTGTTGAAA
GATGCGGCGATCGTGCAGTACGGTTGATAGTCACTAGGGACACCCTATCAGTTGGTACCAGTGGTTCATGTTTCCAAGCTGAGCAAGTGAAGGTATTTTT
TAGAGCGGCCCTAGAATCGGTTAAACATGAGCTAGTCCGATCGAGTCGATTTTTATGAAGCTATAATATCGAAGGATAGCTGGGAAGGGCGATGAAGAGT
TCGAGATATAGAAAATTATGGGGGTGCAATCAGGCCGAAAAAAACGCTCTACGGGCGAGTGCGCTATCATTTTCTGGAATATTGGAAAGATTATAGCGAT
CCGTCATGGGCGGATGAAGCAGACCTAAATTGTGGCGCTTTACTAAAGAAGTTAGATTGCGATCAAGTCAGCCGGAATCGATTTGAAGAGATTCAATTGC
ACGAAGAAGGTCCAGGGAGCTATACCAGATCGGGGTGGTAGGAGTGTAAATATATGCAAGGGGGTTTCAGATGGTTGTAAAGTGAAAAAAAATGCACCGG
GAGGCGGTGTGTGAAGAAGGAAGGCGATGTTTTTATGTGTGTGTGGCGATCGGGGTACGATCGCGGCCAAAGGGTCTGATAAAAACATTGTATCCAAAAA
CTGGAAAGATTAAGGACAGCATGAGTAAATGGAATTGAAACTTGAAAATGTATTGAATTGAACGGATTACGGAGCGACAACTTACCAGCTAGGCCAGGAA
TTGACATAACTGGATGATCCTCAATCGAAGTCCGATATTGATTGCACTACGGCTCGGCAGAGTTCGTCAAAGACAGTGCAGAAGCCAAGTTGTGGATAAT
AGATTGCCGAGTCCCCGACTTGGGATATTAAAACCGCTGCTCGTCAGGCCAGGCAGGTGCAAGAAAACCAGGTCCAGTATAATTTCCATGCAAAAGTGGC
ATTCTATATACCCTAGAGTATGAATCGGAGAACTGTTTTCCAGCGGGGCCCAGATTGCGACCGCCGTTACTTTCTCTGATCGCA