Description :
From Genome Similarity Track
Location :
Scaffold_6:2314494- 2318020
Transcript NameFunction/comments
Phyin_T30-4PITG_04714Putative uncharacterized protein
Phyin_T30-4PITG_04715Pantothenate kinase%2C putative

Sequence
3526 bases(100 bases per row)
GGCAAGGATCCCAGTGGAATTCCCAGCTGGCCGTTGGCATTCACCTTTGCGTGAATGGAAGTGTATGGCGAAGAAGCGTTTACGGCGCGAAGGAGCCCAC
GTGGGCGGTCGCTAGATAAATTACTTAGGTTGGGGCTACTTTACTGAGGGCTCTGCTCGTCTAGCTTCTAGTTCTATGGGGTCTGCTATCATTCACATGA
CCCGCTGGCGCTTAAGCGGGCCGCCACACGAAACAGTGGGTACCACGCAGCGCTCGACCTCGGTGACCTGATACTTGGCCCACAGTCGGCCGAGCATTGC
CTCCTCCTGCTTTCGGCGGATGTAACTGCTGTGCGCTGGCAAGTTGGCGACTGCGAGTCTCTTGGGCGGGACCGGCGTGTGCTCGACGAACAGGCTCGGA
TCTAATTCGTTCAGGTACTCGTCGAGGCTGCGAATGAGCACGCGCTCATTGGTCGGCTGAGCGGTCTGTTGCTGCTGCTCGAGCTGCTGTTTGCGCTCCA
GGAACTCCTGGATCTCCTCATAGTGGCTGCGAGAGCGACTGTCGTGCACGCCGAGTAGCTGGCTCGAGGCCTCATCAAGCCCGCCGACCTGTTCGCAGAT
ATACCGCTGCACGTGGTCCATTTCAGCGCGGTATTTCTGCTCCTTAGCAGGTGATGCGAACTGCAGCGGGCGGCGCACAATGCGGCGCGTCATCGGCTGC
GGCTTCAAGCTGCTACTGCAGGACATAGTGGATTTCGGTGGGCGTACGTACTGGTCTGCAAATAGCGGAATGCCACGGATCTGGCTGCGGAGCTGCTCTC
AGCTCAGCACCAAAGTCCTACGACTGTTACCAGCGCTTCAAGCACTGCGATTTGCCCATCACCAAGCCAAAGACGACACGACGACGGCGTGATTCTTTTT
TGGCTGCCTATTACACACTTGCATCTTAAGGGCTGGAAATGAATGTAACTGTATTGCTTTGATAAAGATGATATCAAACCATATAGACGGGTATTTGTTA
TTGAAGGGTAAGACCGTCACTCCTGCGATGCGTCATCTGGTTCTAAGAAATCGGGAAAAGTAGTCGAATTTTGAGTTTGAATACAAAAAACAAGCTCCAG
AAAATCGGGATCAGATACATCTTGCTTCGAGCTGGATTATTATCGCAATGGCAGGATTTTGGTTCATGACAACGAACCAAAAACAAACGGTTGTCTTGAC
GTCGGCGGTGATCAAGAAACAAAGCCATCACGGGCTGTGGGCGAACAATAACGAACATGGGTTCAATCAGTGTCTATTGCTCAGGCAGATCGGATCGGGT
TGCGGTGCAGCGCTCTGCTGAACGTTGCCCGACATGTGTGACTCCCACGCATTGATCGGATGGTTGCTGTCAATTTGACAGACCCTATTAGTAGCTCACT
TCTCCTCAAATTCCTCGGTCGTTTCGCTTGAATCCCTGGCAAACACGCGATGGGGAGTCGACCTTTCCAGCTACAACTGCAAGCTTATGGCGTCGGATCA
CAGAGCGTCAATAATGGATATCGGATAGGCCTCCATTCAGGTCAACTAGCTTGTGCATAACTATTCACACGAATGCCGAAGATGTTATCCAACTGTAGTC
AGAGTCGTATGTTTATTCGCGATAAGTACTGTAGAAAGGTCGGCCATACATGTAAGCTAAGTTGAATGTGTCAGAAAATGAAGTCCTTTAAGACGCCTCA
TCATTGGCTGAAAGTCGTTAAAAAGGGGAGGGGTTGGAGAAGTTCAATCTTGGACGTCTACGTCATGGACGGAGGGGTCGGCGGCGGCACCGAGCGTGCG
CTGCTGGCGAGCGGCTTCTTGCTCTTTTCCTCAACCGTCGCTCTCTTCTGTCTGGAGCGCAAGCGACACCGTCAGCGCGTATGGCGCCAGCGTCTGACCT
ACAAGAAGCTGTCAAAATCGTAATGTCTTTTCATCCGTTTTTCAGTCATTCCCACTTGGAATCTTCCCATAATTATTAACCGCACCATTGCAATCCCTAC
TACAGATCCGACCTGGGAGCGTCTTTCGGTTTGGACATCGGTGCGTCGGCAAATGGAAGGGAAAAAAATCCATTGGCAAATTTCTGATTCGGATCTGGAC
TGTTGCTGCAGGTGGCACGTTGGCCAAAATCGTGTACTTCGAGCGCCACGAGGCCGGCAACGACACGCGTAAGCGGCCGCGCTCTCCATCGCTGGATGTG
GCGGCAGGCGAGATGAATGAGTTTTTGCGCGAACATCACTCGTTCGGCACGACTGGCGTTCAAGACGTGAGACTGCGGATTCATTCCAAGACGCTCAACG
GAGTGAGTTCGATGCAGCTACAGATGCGAGTGCTTGTAATAACAGTTCTTATCGGTGACTAGATCTTCCACTTTGTACGGTTCGAGAGCAACAAGACGCG
GGACGCCATTGAGTTCATCACGAGCAACGGGATCAATCAGTCGTTGCGGATCTTGCCCTGCACGGGAGGGGGAGCTCACAAGGTTTGAAGTGTGATGACG
GCATCTAGGTTGTGGGTATACCGGACTCATCCTTGTATCTTGTTATCGATCCAACCGGCAGTATGGCCCTGCATTCAATGGGATCGCTGGAATCGAGCTG
GAGAAATACGACGAGATCGACTGCACCATTCTGGGACTGCACCTGCTGCTCACGACGCTGCCTGACGAAGTGTACACTTTTGAGGTATGAGATTGGTGTT
TTGTGCTGGTCTGCAAGAGGAAGGAAACTGAGTCGTTGAGTCTGTTGCAAAACTCAGGTCGTGGATTTCAATTCATTGGCGGCGTCTCGGGTGAAAACCA
TTCGTACTGATACTGAGGAAGATGTTTACCCGTATCTGGTGCGTAGGCCAGTAGTTCCACAAGCCTGTGTTTAAAAACTAACAGCTATCTGTAGCTTGTC
AGTATTGGTTTGGGAGTGAGTGTGCTATATGTCAAAGGACCAGGAGATTATGAACGTGTGAGCGGTAGCAGTATCGGTGGTGGCACTTATTGGGGGCTTT
GTCGTTTGATGACCAACTGTGACACATACGATGAAGCCTTGGACTTGTGTGTCCATGGCTCCAACAAATCGGTGGATATGAGTGTAGGCGATATCTACGG
TGGTGCTTACGACAAATTCAAACTTCCGGCTTCGACGGTAGCCAGCAGCTTCGGTAAAATGATTACAGTATCTCGAGAAAGCGTGAGCGACGCCGATCTC
GCTCGATCACTGCTCGTCATGATCACGCAGAACATTGGCCAAGTTGCCTTTCTGAACGCGACTCTGTACAAGACCAAGAACATTTTCTTCGTCGGCAACT
TTCTTCGACACAACAAGATTTCGTCTCGGACGTTGGCGTATGCAATTAACTTCTGGTCCCACGGGGCCATGGAGGCGCGCTTTTGCAAACATGAAGGATA
TTTCGGAGCTTTAGGAGCATTCTTGCGCCACGCAGAGGCTACCAACGCCCACGGCGAAGAGTTTATATCGGCGGCAAGAAGAGCATCCCGACAGTCCTCC
TAGACACAAGACGATGTTAAAGTTTG