Description :
From Genome Similarity Track
Location :
Scaffold_29:231449- 233130
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010163Similar to scy1: Probable inactive serine/threonine-protein kinase scy1 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G010162Similar to ppk15: Serine/threonine-protein kinase ppk15 (Schizosaccharomyces pombe)

Sequence
1681 bases(100 bases per row)
TAAGATGCACGCACCTGGCGACTTGTAGTTGGCGTCGGCGAACTGCTCAAAGGCCGTGTAGATGTACGACGGTCCGTCGCCCGTGAGCTCTGCGGTCATC
TCAAAGCCGCCGAGCTTCCAGTCGCCGCCCTTCGTGACAAAGATGCTCTGCGGCGTCAGCCGCCCGTGCATCAGCTTGCAGTCGACGTTGATGAAGTGTA
GCGCAAGCAGCACACTGCGCAGCCCCCACGCGACGCTCATCTGGAACTCGTCGCTGTGGCTCCCGTACTGCGCGCGCAGGTCCGCGAGGTACTTGGCAAG
TGGCACGACGCTTTCCGTGACGATGATCACGGGCCCGTTGTTGGCAACCTCGGTACCGTCGATGTACGCCAGAATATTCGGGTGGCGCAGCGTTTTGATG
CGTCTGAGCGCGTTCTGCGTGAGCTGCGCTGCCGGTTGCTTGGACTTGAACACCGACACCGCCTGCGTCGCGTCCGCCTTGCTGCGACCCGCCAGCAGCT
GGAAGTCTGGTAGCAGCTCGTACGCGTCGCCGTGGTCCCCGTGGGTGCCGCTGCTCGCATCTGACGCCGGTGCATTGAGCGCGAAGGGCAGGCCGCCGAG
CGCGTTCGAGCCCACGAAGCCCCCGAGCGTCTTGAGGAAGTTCATACGTGGCTCCTTGTTTTTCTCAGTGTGACCATGGCGGTCATAATGGCAAAAGGTT
GGGTCGGGTCAGGATCCACGTTTGACTACTGTAAAAACCCAAACCCATAAAGACTAGTACTTATAAGAAGGTGTACAGTGCTGTCTTCTGTCCGCTCTTC
GTCCGCTGTGCAGGCGGACGCGAGCGGTTTCATCGAGAGAATGTGGCCAAATGCACAATGCGCCGCGTTCTCGCGACGTCGCAACGCTTCGTTCTCTTTT
CCTCGCCGTCTCGCTGCTTCACACGCGCGCCACATACACACTCACTCACATATACACGCAGATGGGCGTGCTGCTGCTGCTGCAGTTGAGACATCGCAGA
GTGAGAGAGAATTGCTAAACGCCATCGCACTCGAAAAGTCGCGAGAAAGGCAGTCGGCTGTGCGTGGATTGTCATCCGGGCATCCGCACTACGCTGACGA
AGGAATTAACGCCGCCGTTGCTCTCTTCTGCTTCCCTCTTTGCAAATGGATCCGTTGCAGCGCGGTCGCTCCGCTGCTGCGAGCGATGAGAAAGAACAGA
CGGCCGCCGCCGTTTTCTCGGGAAAAGAAAGCGAAGAAGACAGGACGTCACCACTTGCGCTCCTGACGCAGTACCTCGCCATCACGTACAAGCACTGCCG
ACTACAGCAGCAGGACGTAGACGCTGAGGGCACGGAGAGCATGCGGCCGCACCAGCGACAGAAACCGCGTTCACGTGCAACAAACAGCGACCGAAATGCG
TCGGTAGACGAGTCGCCCGTGGTGCCGGTCGCGTCGCGGCGCGTCTTGACTAAGAAAGCCGAGCCCGTCAGCAACAACGGCCTGGACAACGAGGACCGCA
ATCTGATTGTGCGCGTGCGCGACGTGCTTGCGGACGACGGCAATATCCAGACGTTCGCGAAAGCATCTGGACACAAAGCAGGGCATGCGGCGCGGTACAT
CGTGCTCGACTTGCTGGGCCAGGGTACGTTCGGCCAAGTGTTTCGGTGTCAACACGCTGTCACGAAGGACATTGTCGCCGT