Description :
From Genome Similarity Track
Location :
Scaffold_9:231416- 233398
Transcript NameFunction/comments
g5527.t1hypothetical protein

Sequence
1982 bases(100 bases per row)
GCTTGTGCACCTGCATGAGCCCGCGATTCTGCAGGTGCTGCGTCGTCGTTTCTTCCACGGAGAGATTTACACCAGCACAGGGCAGATTCTGGTCGCTATG
AACCCGTTCAGACGTCTGTCGCTGTATTCAGACGACATCAAGGACCGGTACTATAACCTGGGAGGAGACGCCGAGGCGGACAAGAGCATCCTGGCGCCGC
ACGTGTATTCAGTGGCGGACCAAGCGTTTCGCACGATGCTCGTGCCGCAATCGAGCGACAAAAAGACGAACCAGACGATTCTCGTGAGTGGCGAGAGTGG
CGCCGGTAAGACGGAGACCACCAAGCTCATTATGAACTACTTGGCCTACGTGTCGACGAAGCGCACGCGCCGCCCGATTCGAGAAAGCAACTGTGACCAA
ACGACGATTCACGACCGAGTGCTTGAGTCCAACCCGATCCTAGAGGCGTTCGGAAATGCCAGGACGACGAGGAATAACAACTCCAGTCGCTTCGGGAAAT
TCATTAAGCTGGGTTTCACGTCTTCAGGTGAGATGCTGGGCGCTTCTATCTCGACGTACCTGTTGGAGCGCGTGCGTCTTGTATCACAGGGCAAGGGTGA
ACGTAACTATCATATTTTCTACGAAATGCTCGGTGGGAGCTCCCCATCGGAACGTCAAGAACTGGCGCTGCAGGACGTGCATGGCTACGCTTATTTAAAT
CAGTCCGAGTGCTATGAGCGCCTGGACGGCGTGGATGATGCTGAGTCCTATCAGGTGACCCGGCGAGCCATGTCAAGTATCGGAATGAACCCTGATGAAC
AGGTCAATGTGATGAAGATCGTGTCGGCCGTACTGCATTTGGGAAATGTAGGTTTCACGACTGCCACGCGCAATGGCGGGAAGGATGATGCCTCTGTCGT
TGACATGGATGCATGCGGCGACAACATTAAAGCTATTTGCTTACTTCTCGGTGTAGAGGAAGACGTGCTACGGAGTACGTTATGTACGAAGCAGATTAAG
GCTGGTGCCGAGTCCATCACGACTCGTCTGCCAGTAGCGCAGGCACTTTCGACGCGAGACTCTGTGGTGAAGACTCTCTACTCAAACCTATTTAACTGGC
TTGTGGACCGCATCAACCGGAGCATCGAGTACAAGGAAGAAGCGGGCGGCAGTCAGTTTATTGGTGTCGTTGATATTTTCGGCTTCGAGATTTTTGAGCA
GAACCGTCTCGAGCAGTTGTGTATCAACTATGCCAACGAGAAACTGCAGCAGCTCTTTGGTAGGTTTGTGTTCCGTATGGAGCAGGACCAGTACGTTGCT
GAAGAAATTCCCTGGAAATTTGTGGACTATCCGAACAATGACGTGTGTGTAGCCCTTGTGGAAAAACGACACATGGGCATCTTCTCTCTGTTGGACGAAC
AATGCCTAATCCCGCGTGGTAACGATGAGAAGCTGGCTAACAAGTACTACGAATGTCTTGCCGGCAAGCACGAAAGTTTCTCCGTGACCAAACTCCAGCG
TGCGAAGGGTCAGTTTGTGATTCACCACTATGCCGGCGATGTGTGCTACATGACTGATGGCTTTTGCGACAAGAACAAGGACCACATGCATACAGAAGCG
GTGGATCTGCTTCGTACCTCCAAGTTTTCCTTCGTTCGTGCTTGCTTTGCAAACAGCGTCAATACGACCGGAAACGGCAGCCCCAGGAACGGTCGGACTG
AGTCACGTGGAAGTGACTCCACTCGACGACGCTCCGGGGGTATGCTGTCTTCAACGGTTGTAGCACAGTTCAAGAGCCAGCTAAGCTCATTACTGGATGT
TTTGAATGGGACGGAGCCCCACTTTATTCGTTGCATCAAGCCAAACGACCAGGCGAGTGCGTCGCAGTTTGAACGGCGGCGTCTTCTTGAACAGCTTCGT
TGCAGTGGTGTACTGGAAGCAGTCAAGATTTCACGCAGTGGCTATCCTGTGCGTTTCCCTCATGAGGTATTTATCAAAACGT