Description :
From Genome Similarity Track
Location :
Scaffold_9:231407- 233398
Transcript NameFunction/comments
g5527.t1hypothetical protein

Sequence
1991 bases(100 bases per row)
CTTGACCAAGCTTGTGCACCTGCATGAGCCCGCGATTCTGCAGGTGCTGCGTCGTCGTTTCTTCCACGGAGAGATTTACACCAGCACAGGGCAGATTCTG
GTCGCTATGAACCCGTTCAGACGTCTGTCGCTGTATTCAGACGACATCAAGGACCGGTACTATAACCTGGGAGGAGACGCCGAGGCGGACAAGAGCATCC
TGGCGCCGCACGTGTATTCAGTGGCGGACCAAGCGTTTCGCACGATGCTCGTGCCGCAATCGAGCGACAAAAAGACGAACCAGACGATTCTCGTGAGTGG
CGAGAGTGGCGCCGGTAAGACGGAGACCACCAAGCTCATTATGAACTACTTGGCCTACGTGTCGACGAAGCGCACGCGCCGCCCGATTCGAGAAAGCAAC
TGTGACCAAACGACGATTCACGACCGAGTGCTTGAGTCCAACCCGATCCTAGAGGCGTTCGGAAATGCCAGGACGACGAGGAATAACAACTCCAGTCGCT
TCGGGAAATTCATTAAGCTGGGTTTCACGTCTTCAGGTGAGATGCTGGGCGCTTCTATCTCGACGTACCTGTTGGAGCGCGTGCGTCTTGTATCACAGGG
CAAGGGTGAACGTAACTATCATATTTTCTACGAAATGCTCGGTGGGAGCTCCCCATCGGAACGTCAAGAACTGGCGCTGCAGGACGTGCATGGCTACGCT
TATTTAAATCAGTCCGAGTGCTATGAGCGCCTGGACGGCGTGGATGATGCTGAGTCCTATCAGGTGACCCGGCGAGCCATGTCAAGTATCGGAATGAACC
CTGATGAACAGGTCAATGTGATGAAGATCGTGTCGGCCGTACTGCATTTGGGAAATGTAGGTTTCACGACTGCCACGCGCAATGGCGGGAAGGATGATGC
CTCTGTCGTTGACATGGATGCATGCGGCGACAACATTAAAGCTATTTGCTTACTTCTCGGTGTAGAGGAAGACGTGCTACGGAGTACGTTATGTACGAAG
CAGATTAAGGCTGGTGCCGAGTCCATCACGACTCGTCTGCCAGTAGCGCAGGCACTTTCGACGCGAGACTCTGTGGTGAAGACTCTCTACTCAAACCTAT
TTAACTGGCTTGTGGACCGCATCAACCGGAGCATCGAGTACAAGGAAGAAGCGGGCGGCAGTCAGTTTATTGGTGTCGTTGATATTTTCGGCTTCGAGAT
TTTTGAGCAGAACCGTCTCGAGCAGTTGTGTATCAACTATGCCAACGAGAAACTGCAGCAGCTCTTTGGTAGGTTTGTGTTCCGTATGGAGCAGGACCAG
TACGTTGCTGAAGAAATTCCCTGGAAATTTGTGGACTATCCGAACAATGACGTGTGTGTAGCCCTTGTGGAAAAACGACACATGGGCATCTTCTCTCTGT
TGGACGAACAATGCCTAATCCCGCGTGGTAACGATGAGAAGCTGGCTAACAAGTACTACGAATGTCTTGCCGGCAAGCACGAAAGTTTCTCCGTGACCAA
ACTCCAGCGTGCGAAGGGTCAGTTTGTGATTCACCACTATGCCGGCGATGTGTGCTACATGACTGATGGCTTTTGCGACAAGAACAAGGACCACATGCAT
ACAGAAGCGGTGGATCTGCTTCGTACCTCCAAGTTTTCCTTCGTTCGTGCTTGCTTTGCAAACAGCGTCAATACGACCGGAAACGGCAGCCCCAGGAACG
GTCGGACTGAGTCACGTGGAAGTGACTCCACTCGACGACGCTCCGGGGGTATGCTGTCTTCAACGGTTGTAGCACAGTTCAAGAGCCAGCTAAGCTCATT
ACTGGATGTTTTGAATGGGACGGAGCCCCACTTTATTCGTTGCATCAAGCCAAACGACCAGGCGAGTGCGTCGCAGTTTGAACGGCGGCGTCTTCTTGAA
CAGCTTCGTTGCAGTGGTGTACTGGAAGCAGTCAAGATTTCACGCAGTGGCTATCCTGTGCGTTTCCCTCATGAGGTATTTATCAAAACGT