Description :
From Genome Similarity Track
Location :
Scaffold_4:231399- 267948
Transcript NameFunction/comments
Phyca_LT1534100514conserved unknown protein putative
Phyca_LT15345035352-isopropylmalate synthase
Phyca_LT1534503538Hypothetical protein
Phyca_LT153499582E1A binding protein p300
Phyca_LT153483201histone acetyltransferase Gcn5
Phyca_LT1534503539conserved unknown protein
Phyca_LT1534539865chaperone protein DnaJ
Phyca_LT153499903Rap/ranGAP protein, putative
Phyca_LT1534559826PREDICTED: tuberin isoform X12
Phyca_LT1534503541tyramine oxidase

Sequence
36549 bases(100 bases per row)
gcaccgcaataatggcgacgctgccctataaatacataactcgttgcaaccgcttcacttcccagtgctaaccattgcctttcggtgataatgaagcagc
aacactatggacaagctcagatcttgcgcgataacgttcctgtggtcgacctggacaaggaacaacgcacgcgtcggtcctggttgtgggtgtgctcggg
actcgtaagccgagataaaagcgagtgctgtttgagcattgtggagactgtattcgtgaacaagcagcagatctggtcctggtacttcagtgacaaaggc
atcgtacgtcgaaaaccccaaaacagactcacagcggagcaagtgcatcgagcttttgtgcagtatgcggacgccgctttggatccgactcggcccattg
cagtgtgctggttcgacaaaaatgacaatccaggcgctgttccgttcctgacggcctccgacttgttatccttcctgcaatctgtattatccagcagtgg
ttgtagcgctgctatcagtactttcgttcgaccacgaggtgaattggatgccacatgttacgccaacctcgagcacgagttcacgtacgtacgtatggcc
cgattagccgatgctaaagcttgctcctgacgcttgtgcgttgtattaggcttcacaagagtggtcgagtgcagggtaaagtattctggttggcgcttgg
tgggcagcgaattacgagcaaagacgtcaaattaaatgctgtcgtgaacgaactggtccaacaaatggtgaattttcttgaaaagaacaagaaatgtcga
gtagtacgctgtgtatctctattcgtaatggaagatagtgggaaactccagttgtggcggacgtccgcatgcgaaacgatctccgcagccgtgactctgc
cttccgctccgacatttccagaatcgctcgtatcaacgttctccagttcgtatgaagggcctcgtgccatgaatgaacgactcatagctcgtgcccgagc
tgaaggttcccgtgcggttgacgaacggttagtggaagcgattatggcatctccaacgctcccatacaacaggatgttaactcgagtacccgctccatca
atgcgtttggatcctctcggagaattagagagtcgacgccgggcaaatcttgactcaagtgactgggatgaagcgttgtccttccttccagctacgtcct
cgctttctagagggcgaaggcgcgctgcatcagcggttcacctaatgtcgagccagaaacgcggttgttgcggggatttctgtagtttgtctattgctga
gttgacttccagacgaatggaacgtaagaaggaatccacattacttgaccaagctggacaagctagaaaaggtcgacgacggacgagtgttgcaactgct
acagccacagcaaacgccttcatggatgcccatcgcgcagacgatctgctcggacatttggctgaacatcgcaagccttcttcgccccaaagactgcaac
gtgttgaaactctacaacctccgccactgacacacacgattccgtttaaattggtggcacaaactcgagccgaaaagcagctagtggatctctttatccg
acgatatcaaagcggtgaagacggtgactacctagcagaagcgtattacggagacggcgagcctcttggagtcacgtttcccggttactattaccgagac
gtacaggtttgcgctaactgctacgaattctacatgctggtggagaaggttcgcatgaaagctttgaatcaagtcgcacgtcgcgacaggagtccaagtc
ctaacaaatatcggatacagcaagttacaatcactgagcgacaagaagaagaggacgaggatggtatcgacaacaacaagcaggtcgacgacttggatta
cgtctggaagcacgtttgggcacaaaccgccggtgtagctgcagctataaccaagaaagatgcagcagagctctacagttttgtcaatcctcatccagct
gtagccatggtactgagtgggctgggagctttacttttgggatcacgaggtggagactggggagaggtcaaacgcgttatctcgcaggataaattgctag
ctcgcttgcgccatgtggacttggacgctctttcggaacgtgctgtggtgcaagcagcagcccatgctcgtaatccgctttttacaccggctcagatcgc
accaattagttcatgcgccgcacgtttttgcgattggatccgtacggtgctacaggcttacgcatggaagcggaggctcgaaatggaagacttggagaca
cgacgtatgctctgctttctcaagccagaaatcttgccagtcgatgtttctactagtcatttggaaaacgtccaacgtgacgaagtgaccttgaaaaagt
ctagggtaaacgacccaagtagcgatgattctatatccaaaaaacgacatcggagtcaacagaagcaagcagctcgtcgcgcaattcaagcacagcaaat
gtcacgtctggcagctccgtcagggcttcaagatggtgtaggaagcattgccgacagcatcttcacctgtcaggatggagtcacgcagataccatacgcc
atcatcggacagcccatcggcgagaccgtcaagtgcaacctcgtcgtgtttcacgatcttttcgatactctggaaagcacacgagtcttcttccgatcga
ttgtcgctcgaaatgtcggtgctcgagcactattctttaattttccaggccaggcaggtactgcctacaccgtggatgacaaagccactgaagaagacaa
actcgtgctgaataacatgtggctagcgcgtcgagtgcatgaacttctcaatttccttcagcatacagcacagttcgtgaccactggagctcctttccac
attatcggctttggcaatggggcaaatgtagctacgtgctacagtattttgtatggcaaacactacgacggatatttgcaatccctcgcgcttttcaatg
gctttgcaagtgtggatgcacagctcgctgctgttcttcatagtgcagtgaatgtttttgcttgtctaccaccgacacgcccggatttgccagtgtcttt
tttcagcaaatacctcttttccgacgcatatctccaaaaagttgacatgaacttggcgctcagtatttacactgcagtaaccaacgccattacgctagac
ggtagaattcggttatgtcgcggagcgcttcgtcacatggatctaagttctcaactggaggaaatccaagtacctattgtcctcgttcagtctgtggaga
atacgctcgttgcaccttctaatgttgatccattccttcaaggtcgatccaatattcagcacgtgtggtctcatcagcagccacatacaaacgacttacg
atccaagacccgcgcacagttaaggaaagctttagcaacacccaagagcgcatttgtttcgtggatccgagtcggacatgaaatccgccaagaagccaag
ggatatgtgacggaagtactggacatgctcgtgaattgtcaaatggaaatgactgagaaggagcggatagctgcgcaagaaccggacgagcagcaaacga
caaaagcaaaaaacgcagagaagcaggtgccgatcgtgacaaaggagtcaggagctgtagctcaatctcttccaagtaccatcgatcctcacgaatccgc
gttagaccgcccagcccctgtggttcagaaatctaacaaaacgccttatgaactgcagcttgagaagtctgaacgtgatttccaagaggcgatccggacg
cacgaagctcaaaaagcggacagtgaaaagaaaaagtggttgcggcagcaaaaagagcaggtcaagtcaacttcggatgctgacatttccccaataaccc
aattcgttgctcccacgatcatgttgctacctcctgctatcccccctgcagttctgcatccacaagctgccccaaattacagtcacgacgaagaaacacc
gagccaatctcagcctaacgaacgtcgcacagatgacatcgaaagcgtccgagctaaaatccaagctgaagaggaacgtatcgagaaagaagccgaagaa
cagcgtcaaaggcaccgcactgcgacagaagcgcgtatggcggctttgcgagaggaacaagagcgaagacgccgtgagtgggaagaggaagatattaagc
gtttagccgaccttgaagctcaattgcaggctcaacaagctgagcggcttgttgcatcccaacaacgagatctgaaacagcaatcgaaggacgaggctgt
tctctcaaaatctgcaccattcatgccgctggaaccatccgtagaaatgtccattacctccattcagtctccaaaggcgttgctagctccgtctgcggag
gaaacacggcaaaagcttcgagaacaaccagaactcccgagtttattcgaccaacttgaggccgaagaacaagcccgcaaacggcgagagaagaaacaaa
gggttctcgggcctggcccactggcaaagagtcatctgactggagagcagtacgacgaggttcgttcttccctacaggataattttcgagaggacactcg
agccaatgagtcgaacgtgaagcgcgagttgaggcgaagacgcgacgcccaagctactcgagtgcagaagtatcttcgtcgcttcctagccgtgcgtcga
gtagatcggatacgtcgtgagaagcaacaagaacgagttaaaaacttcgctggtggggaaatcgtgcggatagctcggggtcgactagggcgccgacgat
tccgtagagcgtttgaggataaggaggaagaagcgaggcgcttgtacgctgcagttctcatcgagaccattttccgaggctttcattgtcggataacgta
ccgcaaaaagctgcgagaaagcaaagctcgagtgcttcagagggtatttcgtggacatcttggccgcaatcgagctcgaaagctgcgcaaggagcaggaa
cgacgtcgctttcaagatcgaaacgcagctaaactgcaagcaacatggcgaatgtatgttgcgcgtggtttatttctcactgctcggttttcggagcttg
cagcacttgagatccagcggatgtatcgaggtctcttgggccggcgagaggctgcacgaaagaaacagtggcgtgacgcaccaccaggggctgaacgctt
ggctcttggtctccaattgattgaagggagcaaacaggcattcgaacgacagcagagtgagttggacgcactgcatcgtgcacaagaggcggccgagcgg
caagtgagtgctgtccacactgaactacgggaggcagagaaagagctggaagtgctggagcgtgaactacaagagatcgatcaactcgatgccgatgtac
gggaattaacccacgaagcagaacgactgcatgccggtggcgttgagggtttactacggaatcatcgatcttcgcttcaacaccaaaaactcggtaacgg
ggtccctgacgctccattctcgctggaaaatgagggcgtgccgtatgaaataggcgctgaaaatgtgttcgagtcaaaagaagcgatcaagaagcggcaa
gcagacgcttacgccgtcgagatggcgctcagtatcaagcgcagtgaacgtgagaagaagaagcgtgacttagaagcggagtttgccagtgtattcgccg
aggttcaacggaaacgagaagcgctggcagaactagaagagcgactcgcggatatggagcaaactcgtatgcgaaaagatcgcgagtttgcgcgtctgca
acggcatttgatggagctgctggaagagcaaaaactggaacttgagaacttgcgtgaaaaaggtattgaacttgagactgctaccgcgacttcggcggca
gcagcggcagctacagcagctaaagcacgcgagcatgaggcgagatcacaggccatgttcgagtccaccgaggaactcatgaagttccagttcatgtcca
tgtccttgtcgtatttcagttctctcaacatgctcaagaacctgcgcgatatcaatgccgacaccaccgccgctgccatcacgactacagcggagactgc
tgctactgcagcggctgccgctgctgccgccaatatcacgccagtctctgcagcctttgcgaagaagacagatagagatgccattagcaatttgctcaca
acggtgagccagcgcaagcagcaagaactggcacagcaacaacgcgaagaacaggatgctttggctccggggaagcagcagccaatgccggaggaattgc
acgcgtggacggtggatgacgtgggtcgatggctcgacagcttgtcacttcctcagtacaaggcggcattccgtgaggcgccgttgacggcgagttcctc
atcgaacttcgtgccgaggacatggcggaagtcttgggtgtatcgcacaaactccacgtgcgtaaactgattgtagctcgcaacaaactgctgccattga
ctgcagcggaacgagcgcaactggatgctgtgaatcacgaggtcaatgcagcacgagcacgaggacaggaaccggccggaggagaagcgtcgttggaggt
ggacactgttttctcgcaggcgcgcaatggacggatgaagcggttggttgagagtctagatgctggattccccatcgacagcgaggatgacaagggcaac
acattgctgctgcttgcctgtcagaacgtgaaccagaggatggtggagctcctcgtcactcgtcgagccaatatcaaccaccgcaatgcacagggcaaca
caccactgcacttcgccatggcgtacgacggtgaaggcgtactgggtgaatatctgatctctcacggcgccgacgacaccatcgaaaacaacagtggtct
gacagcttacgacgggctcacggccgagtaaaatactttataggcaacaagttggtagacattcgctccagctcgcgtcattcgcgtacgctggacacta
tattttgcgctgatgtagagaagccttccttactcacaccgattagataatacatatcgcttgatcgatcgcggcacactcgcttggtatcataccatga
tggcgattccaggctcagcttcgcgaacaccgacgaagtccttgtttcttggatgttgtatttcttaatcttaggcgtccacccgagcctcagcgacacc
acgtgcctgcgacgccatcatgcggttcacagcgttcacgtaggcagtagccgaagcgaccaggatgtccgtgttagcaccgtgtccaacgaactggcgg
tcacgagtgacacccgtctgcgcgttcacgtgcttctcgtcctcggtcttctcctcctcctccttgtcttcctgcacccgcacagtcacttcacccaggg
cgtacgtgccatccgtcacactctcaacggagaagtcgttcagcttgatgctctcctgacccgtagcgcgcttgatggccacgtaaatagcatcaatagg
accagtgcccatagcggcctcgctcacctcctggccgtccttgtgcgcaagcgtaactgtggccgtcggcttcaccaggttaccggcggtaacatgaacg
gattgaagcgtccagaaaacttcaggcttgaagagctcgtccgagacaatcgcctccatgtcagcgtccgtgaccgtcttcttctcgtcagccagcactt
tgaacttctccacgtagtagtcgagctcctcaggcgtgaggctggtgtagccgagctgctgcagacgcttgctgtacgcgtgacggccagagtgctttcc
aagcaccatcttgttttcgctaagacccacagactccggcagcataatctcataggtagcctggtgcttcaacacaccgtcctggtggattccagactcg
tgagcgaaagcgttcgagcccacaatagctttgttgggctggatcgacataccagtgtagtggctgaccatacggctgcaacgggtgatctgcgttgagt
ccacggacgtgtacacagggaagtgctgcgggcgagtcttcagagccatcaccagctcctcgagggcagtgttaccggcacgctcaccaataccgttgat
cgtgacctccacctgacgagcgccaccctgcacagcggacagagtgttagctgtagcgagacccaggtcgttgtggcagtgcgtggagaagatagccttg
tcgctgccctccgtgttgtcaatcaggtagcggaacagcgatccatactcgccagggaccgtgtatccaaccgtatcagggatattgagcgtcgtggcac
cggccttaatgacttcggcgagaacttcacacaggaagtcagggtcactacgtccagcgtcctcggtagagaactccacatcggaagtaaggctcttggc
gaacttgacagcgtccacagcgcgacggatgcactcgtcacgggaaatcttcagtttgtacttaaggtggatgtcggacgtggccaggaatgtgtgaata
cggtggctaggcgcgtgcttgacagcgtcgtagcagcgctgaatatccttctccatggcacgtgcgagaccgcagatcgtcatgggctcgcccgtggcgc
ggttcgcagtgagcggaccgatctccttggcgatggccgacacggcgtcgaagtcaccgggggacgagatggggaagccggcctcgcacacgtccactcc
cagcgcactcaggctgcgcgcaatgtccagcttctccttgaagttgagcgtagcgccgggcgactgctcgccgtcgcgcagcgtcgtgtcgaagatgatg
aggcgctctttttcagcctcggtggcgactgcgttcgagaaggcgcggcgtgcgttggccctggccgcggaggccgagcgcttggcgatcgtctgcatca
tattgctgggctatggaatcaggagtgaaggtcactcgggctcgggtcaaaatgcggaatgagaggagtcgaggccacgtcggctggttgaaggcggagg
ccgtttgagcaaacgtgcgtacttggccggtgcatcttgtccttgccttgtgtgcaccaccagcatcaatatcttgtaacggaccaatgaaatgttttgt
ttggtgttttgaccaataggatgtgtagaaatgaaacagaccaaggaaaaaatctcctggcggagaggagatcaaaaagtgacaggcaaggtttgtccgg
tgccacactgccacttcaccacaagaatgggtcgatcgtcgtcgtggaaatgtacagcagggaaagtaaacgttgtaaggctgcttcaatgctggcggcg
aggataagcttgaacaagcaagttcaacatgaagggaacgttcctagctggctgccacggcagtaccggtacatgtagtggccaagttggtgcagagtct
gcagaccttgtcgccacgagattttccttgtctgaattgcctcgaactggtggacgacaaggcagctcatcgcgtttcatcttagatacttcgaagtatg
tcggcttggcatcctaaagatggctgcatcaacctaaatgattagagtggtgcttcgggcagtgcagtttggcgccaatcctgaaaggttatctcttgcc
ttgagcgctgtcgcccttttctttgaggcctcatcagctgtttgccttcaacctggcattgcaggcaatcgcttcgatcgaagcagcagtgcggttactc
ttgatgggagtgaagcgggcatgtactacatgtaaatcattgtattatacatgtatctgtcttgcatcaaggtttggcacgcaaacacggtctcaacatg
cctaaatgtaccagttgcgtggtacattagatagagcgctattggctgatttcttcgaaaccgttacggttacgccgcgcggtgcgccattctactttgg
agcacaatcggtagaagacaccgtagagaccccctgtttagcgagcatggcgtctcggcaactacctcccgggcaccttggcaacgacactcgctcccct
atccggtctaatgttgctctgcgatggaccagcaatatcgtggcagcaccccctcctccgcgatcccccgtaaagcgatggccgccggtacaagctcaag
ctccagtagtcacgacagtagcatcaaaggcggcgctccagcctgcggtggaagaaaacacagcagtatctgccttccaatcggcgcgcgctgtgttcga
gactaggaagtcacttgctgcatccccccctccacctccccctatccgccaccgtttcgcattccccattgagaagcagcattctacgacatccgatttg
tcggcctcttcttgtagtacattggactctgagagcgaccgaaagctggaagaaagtgctgcagttaactacgaaccggaaccatcatccccagttcgct
tggtggtgaaaaagatggaggcagagatagtcgacattactttttcaaagcaagctgataaagcgatggcgcactacccagttaattccgttgcaccttc
accggtgactcaagtaccgcgcgaaaacccaacgcaatcccagcaaacacttgttagatcacccagtcatagcgagaccgacccattccaacttcttcta
cccgttgagaatatcccaacgcttcccgacgagattacctgcgtttacgacaaggctgcgattgagatggagaaaaagatcaagaaggtggtgcgtaaac
tgctcaggaaagacaaggcgcggttagaggaattcaaggtgaactcgcggctatttgggactgatttcatggactcaaatgcttatttgaatacgcttat
caaagactttggagcgattcgtgcgttgcaactggtgccatgcttgcttagtatccaaccaaatttggtgaaaagcaaagctctactcctcactgcaaag
aattatttgctacgaaacgaagacgagctgaaacatgaactccagctattgaactcaaagaggatcaccaacgttaaccttgataaggagacgatgcccg
cagctggtgtagtccgtgacgggtcctcgactgaagtatcttccgttgctagtaggaaaacgacttccccgacaagcgacgtggtttgttcgccaagtgg
tcatgctgccagtgatcctacacagcttggtactgccttttccacgactgcttctccagtttttcaacctccttctccttcggttgtaccaccattgaag
actttgcctgcccaacaaaaagtcgatggctctacagaagaggtcatgacaaaatccaaggtggtagaactgacgcctgaatctccaacaatgacacgcg
ccgaaaccccgccaccgttgctaagcattgctgttagcactcccagtagaatctcatcaacgacaccaatcatgcaagattatgctcctaccccagctcc
gacgaaatacactgcatcagaaatatccaccaaagctgaagaggattgcaaaagcctctttggggacactaacaagacaatcacgttggagaagaaccaa
aagccacagcaagctgaaattcctgctgcaccgctctctccggtctcctcggtgcacagcttcgatgaagctgaaagcttgttcggagagcgattgtcgc
cgtcatcacgcaccagccgaaagtccgtgacgtggggagacactcaaacagtggagatccttgacaaaatatctgtgacccagactgcgaaaaagcctgc
tccgcttctctttggtctcgcaaccgcagccgctttcgaatcggacgacgacgagtcggattttagcgattgatattcacatgctcatgtagtatctctg
aatcgtcttggcatggacaccctgtgctacaataaaatgtaaattgctgtgtgatgttcacttttgttgtgacaaatacaagtacatgtaccagtattat
actaccggtagtactatgtacgattattatgctacatagtactactacacttctgtttgtattaatactactttgaagtactactgtagtatttgatgaa
aatactgcgatatgacacaaaacagttttcaatatgccgacaaatagttataggggaggcatgaattctcataatcaattgcgcacgaatgtcttcttcg
ccccagattcagccacgacagcgaccaagcagcggcgccagcttgcaaggagacttccgtgtggaagtaatgggcagccaggagtcgctggatctggatt
gcggcaagttctacacggtagtgagctgtttggccgattgttgcaactgcatttcgtaaaattaatgcttgcctgcaggaatatgttttacgttgttctt
ggattgaacgtaacgggacacccgaggtttgtgttgagaatgctttattgaatttgtggtgactcaattgcatgacgatgctacgtagatctgggacgtt
gttcgccgctatcgcgagttttgtgcgattgacattctggtgaggcagatacaagtcgttttggccaattattgtggggattaacgtggatgtgccggat
gaaagctacgtgaaaagtacccatcgcgagcgccactcttccccttgctgcccagcaagaagtacatcggctcatcgctgtccgctgactttgttgacaa
gcggcagcgcgacctcagctattacatgatgtccattctacacagctgtcctctcgtacgcacactcatttgccgtatgctgcattgcacaactgactaa
atctttggcagcttgtacaggacgagatcatcgactctttcctggatatcaaacggcacattttggagagagcacgggaggaagccttggagaggcgctc
aaactctacacctacgcacacaacaacgagcagcaatggaggtgtaagccccatgcggctacagcactaaacattgaaggaatggaatcgcttccaatcc
gtctgaaaatagtcgctacattctcagtttttccaagagaagcgaagagttcagacgcgcatacattttgtcatataaacgttgaaaacctgtgtaatcc
gataatgaccatcactctgcgcgaagatttcgtggctgcacgctcacacagctaggaccggcctaaacgtggcgcgacggtgagtaagttcgggcgcgtt
cgttacctgcctagacagcccaagacctctccatacgtgaacacaggcgcgtcgcgtctccacagagctcgcaacaagactgaagtgtgccctgcgtcgg
tgagaaaatatcgagaagatggcgctcgccgacatcatgtcggttgaaatgagcgcaaagtacatggactcaagcagctcgtccagtctatcatcagact
cagacgaggggttgtcctccagctcgtcggctatctcctcgtcctcttctgagtcggactcggacgctccacgagcttcgatgaaaaagaaaacagcccc
gaggggacgaacaagcaaggtaattgacgctgcactctcagattacgaagacgattcggattcgaacagcgccatcagcggcggcaggaagaaaaagaag
aaaatgacgaaacctgcagctccaaggcggtctcctactaagaacagtggaaagacgaagaaagcggtgaaaaaggccccaatagcaacaccaccgagtc
tgccccctcctcctccacccccatcacctcctccaatgaccccagatggatcgtccagtaacagctcgtttagtgacagttcaagctcagactcgtcaga
tatgtcggactctgagatggcgttgccgacaattccagctcctccaccacccccacctgctagcatgggctcgactaatactatagctgcttcaaccagg
ccaccaaagcggagagcctcgacaaagaaggtgtcagatgcaagttcgtcgctgaaagttacgctgaagcttccgccggggtttattcctaagagcagtg
gtgcagccgtactgaacccaatcggggcgagtggtaatcgatcaaagctcaattttcacgtgacagatacgaacgcaacaaaacgaccacgaacatcaac
tactgctgcaaaaaaaacaaagtctacttcaagctccagaccttcgaaaaaaaagcagcctgcgcgtcgtgcgcaggcaactgcctctgtagatccaagt
ggagtgctgcctgccttaccaaatgttccgtccggtccaccaattctacccaagctgattccaaaggggccgaccgtgcctgcaggtgaaattcgaggag
caaaagaattatcactcgtggatcctgctctacttgccgacagacctcaagaaatggaagaatcgaacattccggtgcatttcaacgacccgtatgcgaa
tggaggtgatgttttgcgtctcttggatatgtttttcttctgcgatgagaatgggtacgtcatctcgcgtatatttattgagctagtgactattctaata
tttttgcgcgtgcagcaaagcaatcagtctcgagattttggatcagccaaaagaccagcgtccaaaaatcatggggtttggtactgttgtagaacatttg
ccactggcagagcgtcctctcccaattaggcccattctcgcatctccagcatttccgtcgcggtctaaaaagcgcccacgcgcaaactcgtctgcttcta
cccctgcaaagtcaccagcttcgaagtcacgggcaactgttaatgctgcagactttggcaatgaaaatgacactatcaagcgtgcgaaagtagaagatga
aagaatgtaccaaggcgacggtgagttcgaagaggctgatgacaaatattcgctttttgaaaagcgtgtgattttccagcgttcgaatgtgtatcatttc
ccaaagacgttttaccagaatcatttgtctcaattggatgggcaatctgattcggatagtggaggcagcgacctaacatcggacgatgaagaaattcgtt
tgggccgcggtggttcaggtgcaggttcggacaatgacagcgaactcctctcctccggcacgagtagttcaagtggaagtgaaagcgaaaacgacaactt
ttcttcatccacgactggaagcagtgatgcagaaaacggaaagggtgttaactcagatgcccggcgtgcagtgacaactagcacaggagccgaacgcttg
cctcaatcagttacagaagctaaaagacttacatctgatagaatgcaaagaaaaccgagtccccgggttgattcaagaaatgctggactgccgtcagatg
ttgtcgaattaatgcggaccgaccaagctgtggaagttaaggcgacgggtaccccggacgagctcaacttgatggagtgtggatttcgccacccctctac
gtacgcacgtactcgtgtttggttaccggaaattacggactggtgtctcgactacgcagagggggaccctacgttgtgggttgtcacaccacatgcctgg
tacaagatcgctgggccgttatctggactattaccacatttgtcgtatcgtcagacttttaagcacgttcgacatctatttgaagcgagctaccttgtgg
cgtacgttctgaaggaatggctgcccattaataagaaggtgtcatatcgagcaacacttcaacagattattgagctatctctcaaagggagatatcgtgt
ggtacggtggcgtggtgtgtgtattgggaatcgtattgaatttctaacatcaaccctgtgatattgtagtcagcctggtttcttgtgaagaattatccgt
tcatccgagcccagatttctaatctattttccgacaaagacacatacctggaatcgatgttctttaagcaattgcaccgcctgcacgaaaattttacgct
acgccaggcgagacaccaaaaagaaatggccgagagggaagttcgtcgtgtaaaacgtgaaaatgagcgccttcagaagagacaactagttgaagatgag
cgacaacgtttgaaggatgagcgtgacgaagaacgtaagcagaaagaagaagacctgaagtacccagcggaagatttgcgactgcttggggaagatgaag
ctaacacaaacatcctaccattgagctgctcaagtttgagaggtgtacagggctcattgttgggtgaactcatcatggcgtggcaaacgatctgtacgtt
caaagatttcgttggactcgagtcgatttcattggaagctctagtggactgtatcacgactcgttgtgacgaaggcacggatattggtttagcccgcatc
tttatcgcctttttacgagttattctatcggaaaagtcgtttatgtcactattggatgatctcgtcgtggaaggtaatagcaaggtttcggacctgttta
tcagcagtgaaaggacctatggaatttgtgagcgtgcctacggcgatatgttgaacgcagtcacttggcaagaaattctccgccagttaatgtcaaagga
cttgggaatcgacccgtctattggccatgtggagccgttggtgggctgtgagattgttcggcaaacgttatacatgcagaacaactctggcccgtttaat
gccccagttgacacgacgttaaagggactcgaagattactcacaaatcattaaaaacccgatggatctccgcactatcaaaacgaaaatcgagtcgggaa
agtacgagggatctggtggatacgagaagttcgctgaggatattcgtttggtgtgggataatgccgtgctatacaatggtgaggaatctgaagtgggtcg
tgctgctctggcactgtcggatgtttttgaactggactatgagcggtttgttgttgggcgggtacgtgcgaatcaaagtcggattgaaagctgcacgaag
atgaaggaaacgcttcaagatctgtccgcagaacagctcacatccttcaagtactcggatgttgtctatggattgtacgtatcggagttttacgaacttc
cgacggcatacaagattggtgctctctcatggatctgctcggaattcttaactttgtcgagcattcggacgtatatggcatctcaggtggagcaagagat
gctgattcaccggaattacagaaagcgtgctgctgatttggatacgcagcgaaaacacacagaccgactgaggcgcgaaaaagaaaacgcctttagaagg
gattgtgcaaaccagggtattcaccccaattcgcacaacgttttctccgagggtattaagcggcgtcatgagtttatcggcaaattttttgaggatatgc
aggcagagaaaatcgaagacgagaaaaacgtggagcaggagaaaaaggcccaagcggaggctatggccagggagttgagttcacttgttatacgcgaggc
tcctttgggaagagacaggtatcacaactcgtattacatgttcaagcatgatacgaaaccacgattgttcattgaacgtgccgactccggagacttcgtg
gtttgcaaccataaagaccagcttacgaaaatcttggaatggctaaaccctaaaggtgttcgggagctagacttgctgacaaagttggaggaactaaagg
acaagctgcttagcggtttcgagaaggaggaaggcaagcaggatgctgatatcaacgaagagattgtgtggagtgcaaagagtggtattgagcttcagat
gtttcctcttcctggcggtgctgtcaagagtgaggttatgaccatcaccgatgcagatagggttatcaagtcacacgatattgctcgcaagatgttgttg
tgcttgaaacaacaactcgaaaatacgaacacgcttcctgctacgtgggaaggtgaccagacgtggactacccgtgtggaaaatgcgaagtcatttaaag
accaactgaacttgtttgcagaactagaaagtgctgcggtggaagctttgagctcgggagtggaaacgatacgtccttcctggctccgaaaacggcatga
gtggcgattggcactggagggttcatgtacatacgctcagtttgtgtttctgcttcatttactgcttgaagaatttatcaacgttgaagcttttatggat
ctccacatccgattagaccggcaggaatggctcaagttgcgacctaaggacactcgcaactttattcctgaggttggaaaggttgttgtgtacttcggag
atggccattccttagcgttgaaagaagacgagaagtctaagagaaagcgtttcactcaaaagagcgatactccagttcgcaacacgactgtaatttgcac
ggtggagaaagtatcttatcaccatggtggcggcgacccatacgcattggctgtactacagccaattccggatatggcacagtatgaatgcatccgcgag
ccgggagcccttctgtgccctcttccatctcaagaacagagactcgctcgagtgtttttgcgcattttggcaaaactgaagacgctagccgatgctggtc
cgtttctcgaacctgtatccgatcgagagtttccacagtacaaagagatcatcttgcatccgatggatctcggtaaaatgactgcgaaagccagcaagct
ggaatataagaattcaacggagtttatgactgacctgaggctcatgcgggacaactgccagctcttttgcgaaggtcgtttcccgacactgccaccgttg
gcccacaatttggtgtacgtcgcagatggacaaatgaagaagtggagcaaggaaattcgagcatgcgaaggaacatcgggcgagacagcatcagcaacaa
gagacagcacgtcatccccccaaaaagttctcgacaagcaaactgagcctgagtctgaaaagctgccaactaaagagataccatctcgtcccattgtaac
gatcttgcgtctcgaaaatcgattgccagagtacgtggtggatgtcagtcgatattcctgggcggtaaatcgcacgtggcaatgcggagagaagtttcgg
atgctatttcgcaacccgcaagggcagcctggggaatactatggaggtgtgactgcagggtctttaccgtttgatgagcatggaatgctgccgtgggagg
cgctacgtattacgtgggacgaagatgatggctcagacgacaatcgtattaacccatggtacgtaattaggtggcatggaagaataggctgggtttgttt
ctcactcattttgtgatcttgcacagggaggcagagtttcctcgaggtggaaatcgggcgtagatagagataaaagttcccagacccccgacgtacagga
aacgtatgaccaacagcgagaattatcgctggcccaaatgcattgtcaacgttgatgaaaagtgagtgttattggtacctttaccttactactgcatttt
tttccttgtggtgttgtaggtcatttcatttattgatgcttaaggagccagacaagttccactgtggaacctctacctctcatttccgaactcaagggca
ggcaaaaatgtgggggcttgaaaagcatgcgaaccaccagaaagcttttcttgctggaacggcatttgtcgtggtagtactgggttggagggcgctgaag
cgttctgttacattaaaggcagttgatggaagctttcgtcagattcatcgtcctgagtctacgttgcctctgctgggtaacacactggacgccatgtttt
cacagagggagcgttttgtagactggctggccgatcaaagcgcactcgcaagtggaaagccatggctcatgactatcgtcgggcagtctccaatgtttgt
gatttcttctccacagagctacgaagacttgttcaagacccaacgccacatcttcgagcgcggcgccaccatgtcctacatctttaaagattttttggga
gaaggcatcatcgctgtcgatggtcacaagtggacccaacaacgcaagtcagcgagtcacctgttctcgaatcgaatgatgcgcagcgtcatgtcggacg
aggtgcgtgaaaagtgtattaagcttcgtgagcttctggatatctgtgctaaagaggggaagactgtgagcatgaaatcacttatttccaagttcacgag
cgacgtgtttaccaaaatcggctttggtgtggagctgcatggactggatgcaagtaaagtggacatggagaatgaacacccgtttattcaagctatcgac
aacatgtcacgtctcctgcagctccgttgccagcagccaatgttcctgtggcgactaaagcgatttgctgaatgtggctgaggagcgggagggcaagaag
aatatggcgatcatctcatccattgtcaatgacgtcgtggtgaagtcactggccaaaagagacgcaagccctttgacaaccgttgaagagcctgtgctgg
agaacccaaagaccaagacagacaacctattgaccttctttctgcagtctgggctaacaaacgcgcaacaattgcaagatatggccgtgaacttcttctt
tgctggcaaagacacctcgtcttttgtgttgtcctggtttgtggtcatgatgaaccggtaccctgaggttctaggcaagattcgtaaagaaatccgcgag
cgactaccagggctactaactggtgagatcgatgtgccgtcgatggagcagttggctcggcttccttacctcgaagcagccatgcgcgagaacttgcgcc
tgaacaccagtatgaccacacgctcaccaaaccaagacacgactttgagctgtggaactttcatcccgaaagattcgatcgtttatgtctgtcactatgc
gtctgcgcggctaaaaagcacttggggtgaggatgctgcggaattcaaacctgagcgatggattgacccagaaacaggcaatgtgcgccagttctcacca
ttcaagttcgtcacgttcattgctggaccacgccaatgcattggtatgcgctttgccatgttggaactgcgcatggttgctgcaatgctctttagtcgct
tcgatatcaagaccgtcgacgacccgttcgacttgacttacgaactctcgactgttttcccggtcaagggccggctattgtgcacagtgcagctggcaaa
gtccacaagttaatatgacaacagtatcgtgaagaatgcacgaacaaatctcactgcagttagtcacggagcgggcctctatttcttgttgtgtttcttt
ttggttttcttcttcttcttgggagtacttgttccgtttggcagcttgcctattgatccgttcacagcaagctcggcctcctctgctgctattagagctg
ctgcagcagcgtcctccggtttaacggtaaactcatcatcagtgctatctgcatcgtccacgtcgtggttcctgccgttcgggtgatgagaattccgctt
tccttttttctttttctttcgcttcttgttgtcatcagagacgtcatcctccggccatgcgacgtcgtctacgaatcctagagaacgcgcgaattcggat
ccatggtcgatccctgcttgctcttcattcagcatctgccaagagttgttctggtaaccagggcgaacagcttgggggacagtaaagcccaggccattca
cgcacagtagactggtctggtcacgcagctcctgctcaaatccacgccaagtcgtatgcgactgaaggaagttccgcaaaaatgcctcaggggactgcga
agctgcctgtaaacgaatagcgttgcaaatctgcaaaatgtagcccttgttgctggtggtatccccatcggcacggtagtgttctatcagcagtgtaacc
aatttcagcttcttcacaagtacctccagcgcttgttgattatccgtacgtaaggcaatgaacacaagctggtagaaagcggcgtggtacagattgttgt
gcgaatactcaaagaaccatgtgaccagcacacgccagacatttgcatcgaagtgctcgctcatcaaccggggattgtgcgccatcacttccaccaaggc
ctccactagtgtgagtcgcaactctgtaaacggaaccttcacaacatacgccgtatgacgtacagcgccctccggtagtggttttccagattcctcatca
ggcatctcaatgttctgctggctcacgtacttctgaatcaggtacttcaaaatctcgccaagatgttgctccaccagttcatagatcttttcacgcaaag
ggcccaactggttgggcaccaggttcacaatggtagctccgaatgactggtacgggcttgtgggtggaccctgaaccttctccagtacgcttttctgcag
taaacggaagacgcacttcatcgctgctgtgcgttgacccaccgttctctgtggagcctgacttttattcttctcaggctcgacagcagcctggatcagt
ccctcaaccaattcagagcagtacgcggcaggttgcagcaacaattggccgttgtcatccgctgcaaggcggtccagcagttcgacaaacacgtcagcag
ctccaatagtgtgagcctcaccatactcggtactgcacacatgattagcgagcaccagcaacaccttccactctgccaatgcactgaagaacgcccactt
cttaggtggggtagaaacgtacaacctcatcacggcagcactgtgaggcttacagatcatcgtcagaaacagctcagccaccggtgcgtgctccaggtac
ggcaacatcgcgcccatgtatctctgcacggtagccgcatccttgcccaacacgtcgtagacatcatccagataaaagcgaagcagatgatcgatgacgc
ggcaagcgtgacgcaaatttcccttggcatcactctggaacacggggaacagacagcgcgtgagcagtttactcttgtccccgaggaacgtgaggagcgc
ttctgacgtgtcgtcgttcgtcagcagcatcgtagcgcgataggacgtcaacagctcgggtgtcacattctccgtagcttcagcttggcgacgcaacgcg
gcatcctcagcagtggcgactttattggcgtccggaccgtcggccagcgtcgaggtcgagtccgacaggcgagtgatgaagctgatgaactgcgcaagcg
tcgcgtctttgctcagagctgataccagggtagccgacacctgcacagactcttcagctagtacattttgtagtaactcgtcgggagccaccggtgcggc
caccgagtcgcggcgagacaccgtcacttcagtcattgctagtggtcaagcaggggagttatctgtaggcacgggtggtcgtcctgtcgacaggagctgt
tgggataaacaagtgtagggtttgtagagatactggcggaacaaaatggtgtttagttggtgtaaattgaaatatggctacactctatagtctggagatg
ttgctgctgatgctgtttgaaagcctcgagtttggtcatagcttgatcgtagaacgggtatgtggaggctggttggagtagtttggtagcttttgtagaa
cgagtgcgtagtgacaactacgtgcaaatggagtccaaacacggaatctacccggtgcagtggcgttggccacgtcgtagatggctggccacagtcgatg
cgtcgagtcggtgaagataaagtagttgccactactgcactgcgcgaacagcgagcgcagaaacacgtagtcgctgtcgaccagtagacagaagttctcc
acgcacacgaacgcaaagacatgtagctgggtagttgagagggtctggcgcacatgctcattctcctcactatgtagatcgagcgtaatatcacagtgtt
gaaagtccaacgaaacattttgctgtccgaaatgctccagtgtctgcgttgcagcatcgatcgcgcatttccaaccaggttcgttgtcgtacactgtggt
gtggaatttcacgtcccaagctcgaacatactcgcgcataaagacgagtccaatagcgtcataccccggacctcctccatacaacgccatgttccagcac
aaaggttgcttgactctaaacaattccgaccgcaactcactcagctcttccgacatgagtaaattgggcaggttcccgcagcggttgatcttctgttgaa
tgtagccactgcgagcgtgggtattctcgaacgaaggtcgttgtcccgtgttggtggacagacatagtcccttcttgagctccatggtctccgcaactgc
aacagcaggtagacgctccagtagacgtggcaggaatgattggcactcattgcgcatgaaggtggtccagtcgtggcggaaagcacgactgcgaaggttc
cagaccgattttttaggctgcacgtcgccctcgtcagttccactgaactgcagccaaacgcacgtgaacaaccatcggcgacttacagcgcggagcttgt
ggcgctcttgcaaagacagaaatgacaccaccaaggcgccgcagtcggagtccattggaaataattgtgcaacaattattgttgcactaattattctggg
acggggaatatgtaccacaacaacagcttcgtacaactcgctctctgaactgcggacaatgttagataggagacagaatttacaataactaagtaagtac
ataccttgtggttcattccataagcgacagcattcatcgctccctagtagccaaagagtaaaatattgtacattttgagaataagcatttggtgcgtacc
tggaacggggtgaagaagctaatacaatacagaatccaggagctgagctcatggttcggagtcactgcttgataaacgaaagcgaaaacgatccacacgt
tcggaaggaaaaatgcccaagtgtacagaaggaggcgatagtggatgcgtgtctccatattggtggatacgctgtcggtctaagtatttatgttagcgtt
ggacaatgataagcgtaggtacaaaagtacctaccattaagtacagcaacgtcacgtaggtcacgaggttgtgcaagaaagtaagtgcaatcggcacgta
gaaaataacaagctggacgtagaacgcttgttcgctccactgactgtcactccacgagcgtatccagcaccagggccgaccgctttcgccaacaagatct
gttccagaccacaactgcatgtacaaatgagccaccgtcttgatcaaagaagaattagtttcgattccattccagctgaattacacaaacattttaccgc
gacgggtattccccatgccacaaggtgatagcggttctcgtacagctctggagctttacatctctgtgttaatagctgaaaaaggtggaatgcaaaacac
ccagtccaaaagcacgccgccaactggaaaacactaatgaatagccctacaacaaaagaagttagtaaaatttacttctctgaataggaaaagtatctta
cagacctgaatcgtgcatatcctagatgtttgaaacccagacgccacttgatctccttgttttatattcggtaggtaaaacattagaagccacgaacacg
cagcccctgcatccgctagatgcaagcagaacaacaatcgtcgtccacatcttcgcgactctggaaaagccagatagtgcgctatcatcgccagcgctcc
gagcagcgacaccccactagaaattcctacaagtatcttagaagttgagagctcatgagctgcagtgtcgctcatagtcacagtccacttcaatgcgacg
agtgatttggaggcatttctgaatcggatccgtcggatatgtgcggttcctatgaggtgacctttcaattggcaatatacacgagaagatcgcaaaagga
cacttcagatatacaggagtttagtctggggtgaaggtgataccgccatctttctgccgtttaccgcacaaacagccaaagagtttgacgcatggcaagt
cgtaataatacttctcctcggggtcgctgagtactcgatacgcctcctttagcttttcatacttgtacggctccgtttcgttgttgaagcgcttcaccaa
cgtgttgtaggctgcatcgatttgctcgcgactggcagtcttcaccaatcccaactttgcatacatgtctttggctttccacattcgcacctcgtagtat
tcgagctgttgccgtaatgcgtccagtatacgcatctcacagccagcccagtcgtacatatgacgtgcgcaaaacttcttggcgaggatttccacgtaat
gaatgcagcgttggcctccgtgtgactccatttcgcagatccagtccgactcaggacgcacatattccagagtgtgcgataaccctgcgtacgtggcttg
aacagaaaacaacgtgcgccgtggttgcatgcgggtgcactcgactcgagtattgttgcacacgatctccagcagtgttgtattgagaggagcggtctgg
aacaagtcgtgcttttccatgaacgcgtacacgacgtcgactggttcttggccctctaagatctgaacgtctccgagttttgagctggctgactcccaca
caggaatatttatcagcattggctcagcacgcgtgcaattcggacgcttgcgtggttcattgcacacttcgatgaggaacttctggcgttgacgtagagt
caagttgcgcatcagtccatactcgtaaattacgtcggtggaatcctgaccatcgtagaacggcaagcgctctcgttggccgtcaggtagcgtgtagact
gcttcgtaaagaattccaacgtctcgtgtacactcgagcccacttgcctggcaaacaccagaaacgatgctcttcttctcttccggactcaactcatgct
tgttcccgaatcttgcaacagcgtcagcgggttcttcattcgcaagaacttctaatattccaaggttagacccgttttgagcagccaccggcacttggaa
cacaattggagcgtaacgagagcacgttagtggttccttttcgtcctcctcgtcttccacctgctcagatgttgatgtggaggaattacacaaactgtcc
agtaaaacttctcggtccccaggtgcgagattgtgctccttggcaaattgatatacgacgtcggcaggttcttggccttcaaagacgtcaacgtagccta
agacctggccactgctatcacccactggaatcgatcttaaaagtgcttggcctctagtgcaaagaatcccttcacgagtcccacacagcgctcggaacaa
agaaatctgcaagtctcgagtgatgtttacttgtctagaaaacctgcgcacagcatcagctagttcttcgtcttctcggatcgctagcacacccacagtt
gtcccattctctacttccacaggggaagcaaagacaatgggctttaagcgcttacaagccacgtacttgtccccacacaccttcctcaccaagttttgtc
tgaatgatttcgccagcccgtagtgcaagccaaagttgtacacgagatctgctggttcttcgcctaacggaatttgaagcacaccaagttgtcgtggttc
gccggtctcgtcatctctcacaacgatacgctgcgaatacaccaaggggacttttcgagagcattgagcgtcaccaacagcagagcataccacattgagc
aattgttccatcgcaaacatcggtaacttgtagtctttcacaaatctgtagacctgatccacgggctccacgtcgtcatagatttcaagtttccctatct
gtacccctcgatctcccgtaacactcttcgagtgcattaaagcgttacgtcttgaacactttacgcgaggcaccccacagacagcgttgattattattgc
tcttccttctctgccgatgtcatgcagcaacgcaaacccaagcactgcatcagctggctccacgccttccagtatctcaagcttccccaaaattccacct
cctggtgcttggataggggtcgaataaatcatcggaacttcgcgacgacagaccacttgaggtctctgacaaatctgcaccagcatattgtgcctccagt
cgagtgtctggctgtgacgtacgcgaaaggcttctaaagagtccaccggttcttgtcccgagagaagtacgaattgtctgtgctctggtggcggctccag
aggaagttgtaactcaagtaaaacgtccaacgccatgcaggaggcaacgcacagcaagaggaacgtcagccagaaggtagaagctatgaagacccgaaca
tcatcttggcgtcgcattgttcaatgcaggagcgaaattgattcgcgtcccttcgtctggatacgaaacccacaatctgtgacgtggtgcagacttgtac
ctttcaatcgtcgagtttccattcgtctgcagtggcaaggcgaagccccaactgcttgatttgcttcagtcgctcctcacaattcaaggcaaagcccaca
agctcctggtggaaaacttgacaggccaaattcgcattcagacacgtgatcctcacgctttccgagataatagaactggagatgatctgtttgccgtaaa
gcggcccgaacggcgggattcccggcttcacgtgtacttccgttcggtactcgctgtcattgagtggctggatgataatgtgcacgtcgttgaattggcc
agggagtgtttgtatgtcatagtcctcgtcatattcctgcatcaaaatacacggcactgttagaactgagttccaatagctccatcattctactcgtacc
ttaaacacaacgtgcacaaagtcgttcccaatgtgacgtttcttcttcattgatgcaaaattgtctaccacagcgctggtatcagcatggctgcgttcag
gaatcatcattgtggccacgtggaacattatctgcaaattggtataagccacacttgagttttgttttcgaggatgaaatacagcaaagcatcacgtacc
tgagcgcattcatctttgtaggtgagaccgaatttaccatcgctgttgtttgttgtgtcaagccctccggaatagcccggaagcccctccagctttgtaa
aggtgccgaggcctcgtagaaagcgcaagtagcgtagtgatccacctgcgtttcccaggatagcagcctcggaggattgtttatcgtctcgaacgtatag
caaaccaatcttgtgtgtttcatactccggagtacggtctagcacgtttagcgctaggttcagcgatggtccgtcacttagcagttgtggacggttttcc
actgtgatatcgaatagctgcatcatcaaatgcatcggatcgtactgctggtccttgtcgaacaggagaggagaagagtgcgtggtgcctatccagggtt
cactggaagcaggcgtacaggtatctgaaaagtgtagtatccttggcgtcaggacaggggggctcgatggttgatccgtactgtcattgagcgagagttc
agccatctcatccccaattttgtcgctagtattatccacaagtcctatttggccttctgcattgtcatcaccgtcttcaacgtcttcctgaatagcacgg
atcactggtttgcctggcatcccttcttgtccatcgtctccttctgcttgcctggatttttttgaatcaggttgagttacatgttgtgaggattgggagt
gcactacaaacaacatatttgatgtcagaccaaccacttctacagaaatcaattccacttgtcaccttactttgtgcgttgtcataataatacgacggag
aaccaccaattccatcgtaggctggtaacggcggaagtgctgtggcagcaggcgagtgttggaatgattgtgcattgttgtcaaccacagcatcccggta
ggttttcataccacttccatcacgagatctacagttcctctcttggggccttggttgcttcgacgaggatcttaatgaatgcggggttgactggttcgga
taagacggtctcagctctgctggtagcgatcgtttcgtagccccagcacttgctgctcgaggcatatctggtgattgcgattgactgtggcacccgtgca
acttccactggcttgtgcaattcgctcttcggatcactagagacgcgtccccatgtgggcttgttgtgatcgtaagcaacgaccttctataaacccacga
tcttgatctttgattgtcagccgaaactgatgcctcgtctacctcgttcctgttcctgagagctgaagggaagagtgctgactgggaatacgcatagcac
agcaagaaatcaacagcagcctctgcaagaagactgttggctcggcgcgtacactgctgtagcgttggcatcgccaaggcggcaagtgacattctgttct
tgcgatcactctgatgaacgacttggcagagtagacggaaagcaaggtacgcgagctgtcttgactttgcgtattcaaatccaagtagcaatgcttccac
cattgattttcgagcaggaagcgcgatttcttctggttcaccactcaactttggcgttatagtgctcaatagctccagcaccgcaacgaacgcatccggt
cgaaagtccccatcaactgtcgtgacgcaccctcttaaattttgaagaatttcgtcaagctgcataagcactggcttcgtcgcaagcagcgctagcaaac
tcaaagcgtttgtcgtcgtgtgcaagagtttaaactctgcttcaaagagttggcgcaggaaaccttgcagctgggctctgtcttttcgcgatggatggct
tgttgtagtacgcgtagatgttggccctaatgtagatttgctcacagatccagagagtgcgtggaagagattgccgtgagaagcagacgttccgaaccgt
gacaacactcgagacgtaaaaccgagtggtgtactagagtacaccccggttgtattgagctgggactcttcttcatggtgatagagaatattgggcgaag
acgctgacgaagataaagtcgaatccgttgcagaagctgcgctggcgtacaggtctttttcagcaacagccaatcgtagcttcattgtaccagtcaagca
tcgagtgagttcttgcacgctgttatcgagtaaaatggctttgtagctaacaagaagttgcagcagttcgattcccatcgcgaggaaccgtgttttagca
agtaaggcagccgttgcctgtaggcttgcgaaaaatgccacttcagggttctcactccctccagtgctcatggatcttgttgaggcatgaatcgaacgga
caagttctgcatctgtcagatggatcgagcgtccaacgcatctccaatcttcttgcgatttttgctcttgcggaatcagtgccgattcgcttgcttcact
agatgtttgctcatgaagaagtttttcaacctcgtcgggaatagcggctcgaccaaaggcccgataatcgatacttgcaacgacctttactgatatttcg
cccacatccacatcttcgagaatggcacggttttcaagcataatcttgatgccttttacagccatacggaaaagctctgcgtcaggttcagcactcacca
gtgtcagtagagcacgtagtgcacgagctactggtacgtaggcagcagtcaaatgtatgccagtcgcattgatccaagcagcacgcctagacacaaacaa
aaaacgagaggtgcgcacatgttgctgttctttccactgaagtttcccatccgtcgcgcgggcttcacacacatgcagcagacatgaaagcgctacatgt
cgaacagctcgacttcggtgagtttcaactgtcgtggcaagaagatcatacatgcgaacagctcggcctggtggcaaatggtcgaatgctgacgagaaaa
gagcaacgatacctgaagcagccacaagctgagcgtcttcataacttgacagtgtcatcgcactggctaagacgtccagaagcgagtcaaacttcacgct
ttctaactgccgtgcttcttcaattataaagccaagagcacgccggcgtacctctgggtcagtatcttcgtatatccgtccaagcgtcgggatcactact
tcttcaatcacgcggtcttcgcacacgttccgacttgtccacagattgacccgcaaaacctcaagagcctccagtcgcactgtactaggtacaggaagta
aatcaccatcaggactaacacacgagaaaaagattcgcatcacagccgacaaagttgtaagccagtcaaggcggtaccctggatgggcagcttcagctcg
ttgtcgcaacaaaaacagcatcgagttctcactgagatgtggcaaatattcctccagaatattaagaaattcacacacttctccagcaaattggtgctgc
tccacaagatcttccacggcttgcagcgtatcaagaagttcgcgtggaattctcgtttgttggattgacactgaaagttgaggctgtggctcacccacaa
tactttctgggtgaatagccgccgaacggtgcacttttgtgtctaaccttcgtgctccagcatagtcaactcgctgagggtcttcttcgatttcactttc
atcggtcatagacacccacggcctcagagtatgcagcatgcgtaaaatgatatcccattccatgaccagccgccgtttctcgcggttgttgtttacactc
gaggtacccgcaccgcccgatgtgtctgtttcgtggctattgtctcctgaatgtgatgacgacttgactgacgcttctgcagcactggctgaagaatgag
ctgtgccaaatttcttaatcagacgctgaatcgacaagataacctcgaatatgaccactccacggcagcaatgcagagcctgttcaagtgcaagtaagat
aggggcccaagcaatgtcgtcaaacttagccactcgttgagatccccagcaagacattcccacaaaaaacacagcgcctcgaagaacccacgcagaattg
gctccggttgggtgctctagcaactgaagtagaccgcgaagcacaaggaaccctgagcttccattcagtagtagcttcatcaccgaccacgttccatgtc
catcagcattcacaagacagcagagcgaccgaagacacgccgggctactagctgcaaaggctaaatcatgggtggccagcacatgaaaaaaggcgacaaa
cctgcggcacgcgtcgatatcattgcgactccacgccatatcgcatcgcgcgctgataacggacacaatggcgattaccttgtcacgatccagtgctcgt
ggactgcgccgcaaaatactctgaatgagccccagcaggtcgcgctgggcgtccgattgctccaataaccgcagtaagaaccagccaagctcaacatgga
aaggctccaaatgacgaccatcttgtgtcagcgctcgaagggctttttgttgcagcaaaaagtctccaggtgggtgtgtctccagtcgaagatagatctt
tctcctcagcgcgggcgtcagtctttctccaaagcgcagcaagcacagctgcaccacttcaaatgccagtgcacggacacttggattacggtgatcaaac
agatctgcgatgcagtccagcaacgcgtcgatctccgcgagcgtcagggttactttggacgtctgcagtctgtcactggagctcattgagcttaaactac
tgaatgtggagctgctgctcgcgactgagctacgtctatcctctccagcagattcgtgctcttcctgcacgcttcctagagtctctccgtccattagtga
aagtccagggccgggaaatgtggcagacgttactcctccatctgcggaagatgactgcgttcgcagtagcgtcaatatgcgctccacacctcgcacgaaa
gagcgctcttcagagcgtagcctctgtcgtctgcagagcttctgaagctgcagcaccagctcagaggacgcccggtcgctatcatccccaccactgcggc
ttcggctacgccgcccgatgactgcactaagtccgagacctactccacgcgaggtaattgtgctactggaagacgaggagcggcggagatctggtgcgct
tgcggcagcggttaataaggccaccgcatcggttgtctcggttgcatcacaattgggctgctgctggggcgtagacacggtctcggaatctgttgacgca
tctactgcattgtctgacgtgtcttgattaacatccaggtctaaattcgcattgagagagctatcaccgacatctacagccacaagaagagagtcgtccg
acgcaagctccgcgtcttccatttcgtatcagatttgcatcagatagtttcagaacttgcaactaaaccctcaatcaacaatacagcaataacaagtcaa
acatttgagattactacaaaattcggccaaacttattatggttccgctacaggctcggtggctgcatgacagcacccgtgtaggtcggagctggccttgc
cgttcgggtcttcgggcacatccaacgtcgggttgcggtcgaagaaaccttccgggatcatcttgaagccggcgtagtccacgggcatcataggccaatc
ctcaatgcgtgggaaatgcgtgaggccgaacgtatgccacaccacaatgtcttcgccgtcgactgggcggttgcccttcacgtagcttggcagaccggca
aagcctgggtgctggttgggtgtgtaacccgcagcccacagctcgtcgcgcgcgtacttcgtgacccacaggtgcttggtggaaaagttggcacgcttcc
agatggacgatccgtctgcagctaggagaatcggttggccttcaggcatgagcgcatagcccgtagagcggccaaggcgattcttcgcttcactcgaagc
aatacgccacactcggcccttgtccattgcagctactcgctgagcgtcgctctcgttcttcaatcgggttgatgtacgcaggaaggcattcccttgcggg
ttttcagggccgatcggcacgcgtttggcctccagctcgtcgacatggcacttgttaccatcgatagctacgtccagacgagccgagaacaggtgctggt
ggcacggcgcgccgagacgaggggccatttctgtagcgtactcgtactcgccctccgggcggcctgatgtgaacacgatgccggtagccttgcattccag
ctcaatcctaccatccaagtagaagtaccagtagaaaccgtagtcgtagttacctaccgtcacgaagaaagaaaccacaaagcgacgctgacgacgcacg
gttcccgtgggtggggaagccaacacatcagtatgtttccagagcgtgccaaaatcctcttcgtgcatgcagatagcgttcttaatgacaaacggctcac
agaagtcatcgacgactgtcgcgtccaagtactggatcttaccgaggcagtcacaacccagaacaagcgaattcgcaaggcgaccgaactggtactcgcc
cgcatcgaagtagttttgccagtcgtgggtcggtgacggctcaccatacggcaccaccatctcggaaaccgatgcgcgattcaggatcttacgcttgcgt
ccgcggtcgttgaatgagatatcgtgtagtgtgaggccttcacggccgttaaagccgacgcggatctcccagttttgccacgacacgatgttgtccttga
cggtgaagctggcaccttcaggctgcttgatgtgtagtggcttcatgtccgtacgcattggtccagtgatcttagggtcgaggtagtcgcccgactccat
cggaatgtgagtgtagcctgtgtcgaccaatttcaaaactttacggtttgttagatcgacgtgcgccacgagaccgtcgatcgggtgtccatacattgcg
tgtgtgttttccactttgaggaagctaagtacgcggatcatgcggttgcccgcctctccctcatagccgaagacgccggctgagaactgttcgcctcgca
ccatatcgaggtcggtgatgccacgtttggccagcgccgcgacgtagtcaggatcggctttacaaatggagtcgccatcccaatagtcctggtccaggat
cgggatctgcccgtccgtcttggcgtccagctccacctccttgacgatacggcgggccacgacgtccacaacaaagtcgcgcgtgacatttgtggtctga
tcgagcaccaaggcgccaatctcacgcgggatttccgtcaactggccagcattaaacttgtccaaagtagcgtggtcgggctcgaacaacatcacatacg
catagcgcagctccgggctcgagtgccctgcatccgctagaacttgcttcactgtgcggacctcatcggccgtgacgggatcgagtgggtgtttgatacc
cttggaggttgtgtgagcactgggagccatgatggcgttggtcgctggaagggacgaatgcgggcggaagtaaatccggaagtgagcgagagactcggtt
aatgtttctgccttgcatggctaaccgagccctctatgcctctgtggtcccccgatgcttcttttcagctgggtccattaaacgccacgaagagctgcaa
gctagcccagatgatgttacgcattttcatggtaaaacctgcatcgcataaattagtctccggtatcggcggtacaggagtcatccagatggtgttcatg
ttcaacgcctattggcagctgagtgctgtacgcgtggctagtcaccgac