Description :
From Genome Similarity Track
Location :
Scaffold_23:231289- 249768
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10796hypothetical protein

Sequence
18479 bases(100 bases per row)
GAAGTGGATTTGGCCAGTTCACTCGTTACTGCTGGGCTTGACGATAGCAACTTGAGTCCTCCTGACGGCACTCCACTCTCGGCTATGTTGTTGATGGGGA
TGTGACCGTGTAGGAAATATGCTCATCGGAGGAATAACGTTTTGTACTTGCACTTCCTGCGCACATACACGATGTGACGGCACGGGAACAGCCAAGTCTC
ATGAAGATACATGTAACGGGTCACCCCAGTTACATAAGTAGTTTAGTTTAGATGTTACACAAGTAGGCAAAGTGGCGCTCGGGTAGCGTGTGCGTAGTCG
TCGTTATGTGATTTATTGGTAATGGGAGCCAGACCCATTATCACTCAATCATGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCA
GCTGTATACTGCTCTTCAGCGTACTCCCGCAGCGTGATAAAAGTAGACACTAACTGGTCAATATAAATGTTTTTATGGTGACGTCCTTCAGCGTCGTGTA
TCGTAACCAAACGTATAGACATGGTCTCTCAAGTCCACGTGTTCGTGAATGCGTGAAGGCATGGAACGTTACTGCCTCACCTGCGCTGAGCCTTCCACGC
TTGAACATTTTCCCTCGCGCTCCGCGAGGACTACGTGGTGGTGTCATCTTATGCCCGTACGCTATCTGCGTCAGCTCGAGAGACGGCTTCCGAGCTCATG
GAGATCGACGCAAACGATGCGTCAAACCGTCGCTAACGCAATGGTTCTCGCAGGACACGTCGTTGCGCCGGTCGCTCCTGCCGTTCAGCAAAAAAGAAAT
CGGTCAGGGCCAGTAAGAGCGGGATGGAACGAAGGTCCGGGATTCCTCATCCTCGAGCTTGCACTCGAGTCGATGAAAGAAGAAAGCTAAGCATCGACGT
CTGATCCCCGTCGCGAACCCGTGTCCAGTGACAGCTCACCGACGGAGTCGGTCGTGGCGAATTCCCCGATCAGCTGGCAGCTCAGCTGCAATTTGTCTAC
TAAGACGTCGGCATATTCGCGGGCGATCCCGTACACTCGACTACTTGATTTGAGAGGCGCTTCCCTCGACTACACTGCAAAACACTCATCGTGTGCCGAC
TTCAGTTCAGCGCTCTTCGGCCGTGAGGTACTGTCAGCGATGACAGTATCCAGCCCGGACGACGCTGAATCAGCGTCGGTGATCAGGCGTACGAGTTCGA
TGTCACCGTCTTTGAGATCGCGAAGGAAGTTCTTCCGAGAGAGGATTGGAAGTAGGGTAATCGATTGCGCTTCTCGAGGTGGGATTGCAAGCTCGATTGT
GCGTCGGTGTCCGAATGTTCCTTCCTCGTACTCAAGCAGAGATCGTCCTCACGCCCGGCTCGAAATATTGCGTGTCGCGACAGTGGCCGCTGCCACGAGA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGATCGTCCTCACGCCCGGCTCGAAATATTGCGTGTCGCGACAGTGGCCGCTGCCACGAGATCAGGTCCAAGTCATTGACAAGTTATTCTAGAGTCGCG
GCAAGGCGGGTCGCGTCCGTGAAAGTACTTCGCCAAATTCCAGTACGACGTTTTGTGTGACGAAACCCACGGATGATTGGCGTACGATTGGCTTACGTTC
ATACTTTCAACAAACTAAACGGCGCAACCATTCCAGCCTAGACTACGATTCCTCGGAAGGACATGGTACTCGACGCCATGTCGGGTAGCGAAGTGTACAG
CGCCATCGACTTGACCGATGGATTCTATCAAATCCACATGAGGGAGAGCGACATACCCCTCACGGCGGTGAGTACTCCCAGCGAAACGCTCTCGGAGTGG
CTTGTCATGCCAAATGGATTGAAGAATGCCTTAGCCACGTTCAATCGCGTGGTATCCAATGTGCTGCGCCTACTCCGTGATTTTGCTCCGAGTTACTTCG
ACGACATCTTTGTCCACAGTCGCGTTGAGAGCAATCTCAGCGCGCCCGAAGTCCACTTGAAGCATTTAAAGCAAGTCTTCTAAGTGATGCGTGAAAACAA
GCTGTACGCGAATCTGAATAAGTGCATCTTTTGTGCGCCGGAGATTCCGGTGCTTAGCTGTTTCGTGAGCAAGGACAGCGTCCGAGCCGACCCCGAGAAA
CCTGCGCGTGGCCCACACCACAGAACCCCACTGAGTTGCGTCAGTGGCGGGGTCTGGCGAATTATCTTCACAAGTACACGAAGGACTACGCCGGACTGAT
CCAGCCGCTTGCCTCGCTGTTGAAGAAAGACGCGGTATGGTCGTGGACTCTAGTGCACCAAGGCACCTACGACTCAGTGAAGAAAAACCTGGCAGAGGCT
CCTATCCGTGCTTCCGGATGACGCGAATCCTTTTCACATCGTGTGTGAAGCGAATAACTTCGCCATCGGCTGTGCACTGATGCAATTCGACGATGTAGAT
CGGGAATGAGTCGTGAGTTACCAATCCAGGCAGATGAAGCCGGCCGAGAGGAATTACCCGGTTCATGACAAGGAATTCCTCGCGATGAGATACGCTCTGA
TCACCTTCAGAGTGCTGTATTTACTAGGTGAAAAGACCTTCGCGGTTTATACCGATCACGCATCACTGAGAACAGCGATGAAGAGCCCGCATCTGTCCCA
CCGGATGGCCCGCCGGCTCTCGTTCTTCTCTGGATACAACTTCGTTGTCCACTACAAGTCTGGTAAGAACAATATTCTCGCCGACGCTTTGTCTCGGTGT
CTAGACTACGACCCACGAGGTTCATTGGATCGACAAGTCATGCTGGATGATGACGATGTTGATGAATGCGCCATGTGTCAAGCCGCATCAATATTGGACC
TGACGAGCGTCCCTCAGAAATACCGCTTCGCGACGAAATCTGAACTGCGTACAACCATGATCCGACGTACTCCAGTATTCCGGAGCTCTTCTGCTATCCC
AGCGATGATACACGGAGAGATCTCTCGTGATCCATACTGACCCACATCGACAGTTACCGTCTTGAGGATGATTTACTGAGCTCTAGCATCGACAACTTCG
ATGCTTCTCGTATTGTGGCTCCAAACGACTCCGACCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCTTTGAGCTCTTGGGAACGAAGTTATCGACGTCGACGACAGCCCATCCGGAA
ACGGACAGCCAGACCGAGCGTGTGAACCATGTCCTCAAAAAATATTATTCGAAGCTACGCAGCGCCTTTCAAAAATTGGAGCTCGTACTTCCCCCCCCCC
CTCCCCGCAGAATTTGCGCTAAACAACGCGGTACATGCGTTGACTGGTTTGACGCCGTTCTTTCTTAACAACGGGCGGCACCCGCGTGTTTCAACCCGCC
CCGCCATGGGCCATCCCACGTCACCACGGGTCTCCACTCTGGGCCGGGAAAAAGCTGGGTGCACGGAGTCCGCCCCAAATACAACACCACCAGTGACAGG
TGCTGAGCCGACCGGCATCTCTACCGATTGCCAAGGATCTGTCGAGTGTAGCCTTAACGAACTCGTCGGTTAATGCGGTGACGCGCGCTCAGGCCAAGAT
TTTGTCGACGTCGCACGACGCGACGACTACTCACGTATCCTGGACAGATCGGAACCTGATTAATCTTAGTGCCGTATCGAACGCATCGCCAGTGAACTAT
GGGCCGAGGCAAGCAACGCGAGCTGTCGGCTCCGCAGTAGTATCCGATTTTCTGGTGCAACGCCTAATGATCGCCCGGACAAACGAGGAAGAAAAAACAC
AGCTTTGTTCACGACAGGAGAACGCGTGGTCCTGTCGACAGATGGTATTCGTGATTCAGCAGTCACCAACCTCGGCGCGAGCCTTTTCGCACCGCTCTAT
ATTGGGTCGTTCAAGGTGATAAAAGTACTCGGCGAGGCGTAAACGCTCGATATCCGATGCAGCTGCACCGGACGTTTTACGTCGGCCGCCTCAAGAAGTA
CCATCCATCCGCAATCCCGAACGTTCACACGTCTATGGATAGTACGCCGACATTCCAGCGAGACGGGCCTCTGCCACTGATTGACGCTTCACGTTGGATC
GTTGAGCAAATTGTCGACCACGACACACATCAGCTCTGCGGTGCTCGCGGTGGTCAACCCGGAGAGTCACCACGAGGTCAAAGCCCCGCTGAACAATGAG
CGATATTATCGAGTGAGTTGGCTCGGTTGGTCCCCTGCTGATGATACTTGGGAACACCTCCGTGACACGTACAGACAGACACCGCTTTTTGGATAACGCA
TGTCAGGCGTGGCGATCACCATACACTAAGCACCCAATGATGACTACAACCCACGCGAGCGACAAAGCAGGTTGTCGTGGGACATCGACGATGTTATGCC
CATGATCCTGCCTGCTCTGACGCTGACAATCGACGAGGCGCTTCACAAGGATCCAGCTGCGTCTCGGCAACCTGGCCACTGCCAGCGCCGGTCCGCGAGG
ATGATTTCCAAGCTGTTGTTCAATACCGTTGCTAACGCGAGGTTGAAAAATCTAAAGTAAGTTTGGGATTGAGTTCGTTTAAAATAGCTACCTCTTCTAC
GACTCCTGTTTTAACAGCCTCCTATCCCATCTTGCGTCCCAGATGAGGATCCCCGAGCATACCAGAAGAGTCGTAAGATTGCGCATATAAAGTCGTACGA
TAACTGCGCAGTATAGAGTCGTATGATTTTACAAAACCTGGGAGTCATACGATTCTGCGGAAAACGAGTCGTACTATCCTGATTGCACCATATCCCACAT
GCAATATCCAGTGAGCGCAAGCGCGCGACATCACCCATGAACCACTTCCGGGTCGACAATTGTGCTTGGTAGTTGACCTCGGATCCGATGGTATTCAGCT
GTATACTGCTCTTCAGCGTACTCCCGCAGCGTGATAAAAGTAGACACTAACTGGTCAATATAAATGTTTTTATGGTGACGTCCTTCAGCTATTCCCACTT
TGTCTCGATTCGATTGTTTGCGTTGTTCATTAGGTGAGGAACATTTCCCCGAAAGTAAAGCACCCACCCGTGTTATTTCACATCCAACTTCTCTACGCAG
GTCTTAAAGAAGGACTACGAAGGATCACCACCGAGTGCTCCAAGCATAGAGTCCTTGGCAACTTCTTACTCCTCTGTGCTCTTAGCGTATACCAGTATAC
TAAGTAACGACTTCACGTCCGCCTTTCCGGCTCCAACGTAGCGAGCAGCTTGCTTTTTAAGCCAAGTAATCACGTGCCATTGGCACAACAACGGACGTGC
TTGGGGCAGCATCTCACAAAGTACGGCCTTCTCGTGGACCGCCTTGTCGGTCATCACAACTTGGATGTTTTTGAGGCCAATGTTGTTTTCTTTGAACATT
TCCAAAACACGAGTCAAATTCACGTTTTCTTCACTCTACACGAGCATGATATAGGTATTGACCCTAAGGGTACAAGCTAGATAACCACATCCATTACAAT
AGAATCGGATAAATATTAAATGCACACCTTGCCAAATACGTCGTGAACAACAAAACTAAACAATTTGTAGCAGTTTGAATGTGTATGGTGAGCCGAATCC
ACGATAATGCCTTCAGGAAATGCTTCGAACAAGCTCTTCATCATCGCAGTTTGAAAAGTCACTACATTGGCAACATTCCGGTCACCGGCGACATGTAAAT
CCGCTGAGTTGCCGACGTTTTGCCCACAAAATTAATCCAGCAATAATCGCGCTTGCTCCGCGCCGGTGAGACCACCTTTTTGACGAATCCTAATAGTATG
CACGGGGTTATGAACGTCCAGGAGAGAAGTCATTTTGTCTAATGTACACTACAACATATAAAAAATACATTTGTATGCAATGATAACCTTAACCACATTT
ACACCAAATTTAACCAAACAAACTCCACGACTAACTGTACGCTCACGAAGATACTGCCGAATGCCCTCCGCGCTAGCTCCGGCCCTGTGCAAGCTACCAT
GTCCTGTGTAAGCTGAGGGTCTTTTGGCGTCCGATTCTTCGAATAGTGATTCCGAGCATGCATTGTCAGGTTGTGGTTGTGGCAGCCCGATGTCTAACCT
TTCGCCACCCAAGAGCTATTCGCAGTTGCAGCCACGCGTACATTGACCTTAGCATTGCAAATCGTTGGGCAAATTCTACTGTGCTTTCGTCCCCATTCCC
ACGGGCCTTGTAGGATTGAGAATGGTACACGTGTACGTCTTCGAACCCCCCCCCCCCCTTCCCCCTCATCGGTCTAGAAGCAGCACCTTTTCCCTCGCGC
TTGCACTTGCCGGTCGCACTGTTGGCCTTCCACAAGTTTTCCATCTGCTTGTTCCGGACTGCTATGGAGTTACTTTCTCTTTTAGAGAACGGTTGGAACG
CTCTGCAGTGGAGCTGATGAAGTTCCTCTTCAAACTCGTCCCATGTCTTGCACGTCCTATTGAATCCGTCCAAATTGATCGACACTGCAATCTCTGCTGG
TCGGTCAAATGTTCGGTCCGTATTCACCGAGCCGTCTGAGCTTGGTGAGATTTTGGTGACGTACCAAACGTAGGCTCAGCCACAAATGCACCTCTCGCTT
CGGCACTGCCCAGCATGCCTCCTCGGCATTGCTGCCAGCTCGTCCATTGACCCCGTCTTTTTATCCACGTCGAAGTCAGCTCCAGACGAACAGTCTTCAT
TGCTTGCGGCAGCCTGAGTCGCCGGAACATCCTCAAAGTCGGAGTCGGCTGAGTTGTTCGACGATGGCTGGTCGGCCGCCATGTGAAGCGCCTAAAACGC
CTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTG
CCAGTCGATGCGAAACGCGCACTTTGTTTTTGTTGTTATTGTTTTGTTAAGAAAAAAGTCAGATTTTCCCGCCCGAAAGTAATTATCTTCGCAGAATACA
CAGTTTCACCCGAACCACGTAAAATTAATAGCCCCGCAAAACACTGATACTATTCGTATGGACTCGAACATCTGATTAATGTCGCAGCAAACTTAAAGTT
TGGATATAATAGAAAATAGAATAACATTTTTTATAATGCTACGATACAACGTTTATTTATAAAGAACTGTGAGAGCGGTTTTTTTTTTAGATATTTATGA
CTGGAGTACTAAATTTCGTATCAAACGGCTTACAACACTCTAACCCACTGGAAACGTGGACAATTAACATGAAGCATAATAACTGAGATAGATAGAACTG
ACAGTATCAGTCTGTCAGTTCTATAAAACCTATGTTAATATTGTTAGGGCAAGAAGCTATCGCTTAACATTTGTAAATCAAGTGTATAGTGCGATGAATG
AGAGAAATGTTGTAATGTTTTGGTATAGTTATACCAAGGAGGCTCTGATTGTAGAAAACACATTATATCTATAGATTGCACTGATCAACTCGGGGAACTT
TGACTTGATAGCCATTGTTATAATGATATACACAATTTGAAGGCTTCAATGAAATAAATGGTCTAAATGAACTATTTAAAAGAAATGGGCTGAAGGAAAT
ATTTAAGACTAATGGATAAACAAATGGAGGTTTAAAAATGCCATAATACCGCCAAAGTGTAGCGGAGGCGGGAAAGACCTTACAAATTTCGACTAAACAT
GAATTGTCGCTGTATAGCGGCGGCGCTCGGTTAGTGTATAATAACTATAATTGGATGGCAAGCGCTTCTCGAGTTTGTCAATTGGGATGCTGCATAGTAC
TAAAGTTTGGGTCTCGTAGGTGTCAGCCAGACTAGATTGATCTTACATTGAAGGCTACAACTGGTTTTGCAACACTGACGTCCGCTGTCTGGCTTGCCGA
CAACATTCAGTTCTCGGTTCTCATGATCTAATGTGCAGGCTCAATTTGTGGTCATCAACCACAACAGTGCATGGATTTGGCTGTAGTTCGATGGATTTGT
CCCATGTGGCTTTAATCTACGTCGAATATTGTTGTGTTGTTAGTCATTCCGCATCGTTGGATGTGGACGGATTCCGACGTTATACGTCTGATTGGTTTTG
TGTTTAGGACGATGGTTATTTTAAGATGTTACCCCAGATGATGAGCATCGCGGTGATGATATTTCCGAGCTGTTCATGCATCAATGATGAATCACTCTGT
TAAGGAGGAGTATCTCACAACTGAGATCGTAGCTTCTTCTCCTCCAAAGTTGCTGTGCAAACTTCACACAAGGTTGTAGGTGCCAGTAGCAATGTGGTGG
AGTGGGATTCACAAAATCGCGTTGCGATCCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN