Description :
From Genome Similarity Track
Location :
Scaffold_23:231286- 249775
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10796hypothetical protein

Sequence
18489 bases(100 bases per row)
ACCGAAGTGGATTTGGCCAGTTCACTCGTTACTGCTGGGCTTGACGATAGCAACTTGAGTCCTCCTGACGGCACTCCACTCTCGGCTATGTTGTTGATGG
GGATGTGACCGTGTAGGAAATATGCTCATCGGAGGAATAACGTTTTGTACTTGCACTTCCTGCGCACATACACGATGTGACGGCACGGGAACAGCCAAGT
CTCATGAAGATACATGTAACGGGTCACCCCAGTTACATAAGTAGTTTAGTTTAGATGTTACACAAGTAGGCAAAGTGGCGCTCGGGTAGCGTGTGCGTAG
TCGTCGTTATGTGATTTATTGGTAATGGGAGCCAGACCCATTATCACTCAATCATGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCAGCTGTATACTGCTCTTCAGCGTACTCCCGCAGCGTGATAAAAGTAGACACTAACTGGTCAATATAAATGTTTTTATGGTGACGTCCTTCAGCGTCGT
GTATCGTAACCAAACGTATAGACATGGTCTCTCAAGTCCACGTGTTCGTGAATGCGTGAAGGCATGGAACGTTACTGCCTCACCTGCGCTGAGCCTTCCA
CGCTTGAACATTTTCCCTCGCGCTCCGCGAGGACTACGTGGTGGTGTCATCTTATGCCCGTACGCTATCTGCGTCAGCTCGAGAGACGGCTTCCGAGCTC
ATGGAGATCGACGCAAACGATGCGTCAAACCGTCGCTAACGCAATGGTTCTCGCAGGACACGTCGTTGCGCCGGTCGCTCCTGCCGTTCAGCAAAAAAGA
AATCGGTCAGGGCCAGTAAGAGCGGGATGGAACGAAGGTCCGGGATTCCTCATCCTCGAGCTTGCACTCGAGTCGATGAAAGAAGAAAGCTAAGCATCGA
CGTCTGATCCCCGTCGCGAACCCGTGTCCAGTGACAGCTCACCGACGGAGTCGGTCGTGGCGAATTCCCCGATCAGCTGGCAGCTCAGCTGCAATTTGTC
TACTAAGACGTCGGCATATTCGCGGGCGATCCCGTACACTCGACTACTTGATTTGAGAGGCGCTTCCCTCGACTACACTGCAAAACACTCATCGTGTGCC
GACTTCAGTTCAGCGCTCTTCGGCCGTGAGGTACTGTCAGCGATGACAGTATCCAGCCCGGACGACGCTGAATCAGCGTCGGTGATCAGGCGTACGAGTT
CGATGTCACCGTCTTTGAGATCGCGAAGGAAGTTCTTCCGAGAGAGGATTGGAAGTAGGGTAATCGATTGCGCTTCTCGAGGTGGGATTGCAAGCTCGAT
TGTGCGTCGGTGTCCGAATGTTCCTTCCTCGTACTCAAGCAGAGATCGTCCTCACGCCCGGCTCGAAATATTGCGTGTCGCGACAGTGGCCGCTGCCACG
AGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGATCGTCCTCACGCCCGGCTCGAAATATTGCGTGTCGCGACAGTGGCCGCTGCCACGAGATCAGGTCCAAGTCATTGACAAGTTATTCTAGAGTC
GCGGCAAGGCGGGTCGCGTCCGTGAAAGTACTTCGCCAAATTCCAGTACGACGTTTTGTGTGACGAAACCCACGGATGATTGGCGTACGATTGGCTTACG
TTCATACTTTCAACAAACTAAACGGCGCAACCATTCCAGCCTAGACTACGATTCCTCGGAAGGACATGGTACTCGACGCCATGTCGGGTAGCGAAGTGTA
CAGCGCCATCGACTTGACCGATGGATTCTATCAAATCCACATGAGGGAGAGCGACATACCCCTCACGGCGGTGAGTACTCCCAGCGAAACGCTCTCGGAG
TGGCTTGTCATGCCAAATGGATTGAAGAATGCCTTAGCCACGTTCAATCGCGTGGTATCCAATGTGCTGCGCCTACTCCGTGATTTTGCTCCGAGTTACT
TCGACGACATCTTTGTCCACAGTCGCGTTGAGAGCAATCTCAGCGCGCCCGAAGTCCACTTGAAGCATTTAAAGCAAGTCTTCTAAGTGATGCGTGAAAA
CAAGCTGTACGCGAATCTGAATAAGTGCATCTTTTGTGCGCCGGAGATTCCGGTGCTTAGCTGTTTCGTGAGCAAGGACAGCGTCCGAGCCGACCCCGAG
AAACCTGCGCGTGGCCCACACCACAGAACCCCACTGAGTTGCGTCAGTGGCGGGGTCTGGCGAATTATCTTCACAAGTACACGAAGGACTACGCCGGACT
GATCCAGCCGCTTGCCTCGCTGTTGAAGAAAGACGCGGTATGGTCGTGGACTCTAGTGCACCAAGGCACCTACGACTCAGTGAAGAAAAACCTGGCAGAG
GCTCCTATCCGTGCTTCCGGATGACGCGAATCCTTTTCACATCGTGTGTGAAGCGAATAACTTCGCCATCGGCTGTGCACTGATGCAATTCGACGATGTA
GATCGGGAATGAGTCGTGAGTTACCAATCCAGGCAGATGAAGCCGGCCGAGAGGAATTACCCGGTTCATGACAAGGAATTCCTCGCGATGAGATACGCTC
TGATCACCTTCAGAGTGCTGTATTTACTAGGTGAAAAGACCTTCGCGGTTTATACCGATCACGCATCACTGAGAACAGCGATGAAGAGCCCGCATCTGTC
CCACCGGATGGCCCGCCGGCTCTCGTTCTTCTCTGGATACAACTTCGTTGTCCACTACAAGTCTGGTAAGAACAATATTCTCGCCGACGCTTTGTCTCGG
TGTCTAGACTACGACCCACGAGGTTCATTGGATCGACAAGTCATGCTGGATGATGACGATGTTGATGAATGCGCCATGTGTCAAGCCGCATCAATATTGG
ACCTGACGAGCGTCCCTCAGAAATACCGCTTCGCGACGAAATCTGAACTGCGTACAACCATGATCCGACGTACTCCAGTATTCCGGAGCTCTTCTGCTAT
CCCAGCGATGATACACGGAGAGATCTCTCGTGATCCATACTGACCCACATCGACAGTTACCGTCTTGAGGATGATTTACTGAGCTCTAGCATCGACAACT
TCGATGCTTCTCGTATTGTGGCTCCAAACGACTCCGACCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCTTTGAGCTCTTGGGAACGAAGTTATCGACGTCGACGACAGCCCATCCG
GAAACGGACAGCCAGACCGAGCGTGTGAACCATGTCCTCAAAAAATATTATTCGAAGCTACGCAGCGCCTTTCAAAAATTGGAGCTCGTACTTCCCCCCC
CCCCTCCCCGCAGAATTTGCGCTAAACAACGCGGTACATGCGTTGACTGGTTTGACGCCGTTCTTTCTTAACAACGGGCGGCACCCGCGTGTTTCAACCC
GCCCCGCCATGGGCCATCCCACGTCACCACGGGTCTCCACTCTGGGCCGGGAAAAAGCTGGGTGCACGGAGTCCGCCCCAAATACAACACCACCAGTGAC
AGGTGCTGAGCCGACCGGCATCTCTACCGATTGCCAAGGATCTGTCGAGTGTAGCCTTAACGAACTCGTCGGTTAATGCGGTGACGCGCGCTCAGGCCAA
GATTTTGTCGACGTCGCACGACGCGACGACTACTCACGTATCCTGGACAGATCGGAACCTGATTAATCTTAGTGCCGTATCGAACGCATCGCCAGTGAAC
TATGGGCCGAGGCAAGCAACGCGAGCTGTCGGCTCCGCAGTAGTATCCGATTTTCTGGTGCAACGCCTAATGATCGCCCGGACAAACGAGGAAGAAAAAA
CACAGCTTTGTTCACGACAGGAGAACGCGTGGTCCTGTCGACAGATGGTATTCGTGATTCAGCAGTCACCAACCTCGGCGCGAGCCTTTTCGCACCGCTC
TATATTGGGTCGTTCAAGGTGATAAAAGTACTCGGCGAGGCGTAAACGCTCGATATCCGATGCAGCTGCACCGGACGTTTTACGTCGGCCGCCTCAAGAA
GTACCATCCATCCGCAATCCCGAACGTTCACACGTCTATGGATAGTACGCCGACATTCCAGCGAGACGGGCCTCTGCCACTGATTGACGCTTCACGTTGG
ATCGTTGAGCAAATTGTCGACCACGACACACATCAGCTCTGCGGTGCTCGCGGTGGTCAACCCGGAGAGTCACCACGAGGTCAAAGCCCCGCTGAACAAT
GAGCGATATTATCGAGTGAGTTGGCTCGGTTGGTCCCCTGCTGATGATACTTGGGAACACCTCCGTGACACGTACAGACAGACACCGCTTTTTGGATAAC
GCATGTCAGGCGTGGCGATCACCATACACTAAGCACCCAATGATGACTACAACCCACGCGAGCGACAAAGCAGGTTGTCGTGGGACATCGACGATGTTAT
GCCCATGATCCTGCCTGCTCTGACGCTGACAATCGACGAGGCGCTTCACAAGGATCCAGCTGCGTCTCGGCAACCTGGCCACTGCCAGCGCCGGTCCGCG
AGGATGATTTCCAAGCTGTTGTTCAATACCGTTGCTAACGCGAGGTTGAAAAATCTAAAGTAAGTTTGGGATTGAGTTCGTTTAAAATAGCTACCTCTTC
TACGACTCCTGTTTTAACAGCCTCCTATCCCATCTTGCGTCCCAGATGAGGATCCCCGAGCATACCAGAAGAGTCGTAAGATTGCGCATATAAAGTCGTA
CGATAACTGCGCAGTATAGAGTCGTATGATTTTACAAAACCTGGGAGTCATACGATTCTGCGGAAAACGAGTCGTACTATCCTGATTGCACCATATCCCA
CATGCAATATCCAGTGAGCGCAAGCGCGCGACATCACCCATGAACCACTTCCGGGTCGACAATTGTGCTTGGTAGTTGACCTCGGATCCGATGGTATTCA
GCTGTATACTGCTCTTCAGCGTACTCCCGCAGCGTGATAAAAGTAGACACTAACTGGTCAATATAAATGTTTTTATGGTGACGTCCTTCAGCTATTCCCA
CTTTGTCTCGATTCGATTGTTTGCGTTGTTCATTAGGTGAGGAACATTTCCCCGAAAGTAAAGCACCCACCCGTGTTATTTCACATCCAACTTCTCTACG
CAGGTCTTAAAGAAGGACTACGAAGGATCACCACCGAGTGCTCCAAGCATAGAGTCCTTGGCAACTTCTTACTCCTCTGTGCTCTTAGCGTATACCAGTA
TACTAAGTAACGACTTCACGTCCGCCTTTCCGGCTCCAACGTAGCGAGCAGCTTGCTTTTTAAGCCAAGTAATCACGTGCCATTGGCACAACAACGGACG
TGCTTGGGGCAGCATCTCACAAAGTACGGCCTTCTCGTGGACCGCCTTGTCGGTCATCACAACTTGGATGTTTTTGAGGCCAATGTTGTTTTCTTTGAAC
ATTTCCAAAACACGAGTCAAATTCACGTTTTCTTCACTCTACACGAGCATGATATAGGTATTGACCCTAAGGGTACAAGCTAGATAACCACATCCATTAC
AATAGAATCGGATAAATATTAAATGCACACCTTGCCAAATACGTCGTGAACAACAAAACTAAACAATTTGTAGCAGTTTGAATGTGTATGGTGAGCCGAA
TCCACGATAATGCCTTCAGGAAATGCTTCGAACAAGCTCTTCATCATCGCAGTTTGAAAAGTCACTACATTGGCAACATTCCGGTCACCGGCGACATGTA
AATCCGCTGAGTTGCCGACGTTTTGCCCACAAAATTAATCCAGCAATAATCGCGCTTGCTCCGCGCCGGTGAGACCACCTTTTTGACGAATCCTAATAGT
ATGCACGGGGTTATGAACGTCCAGGAGAGAAGTCATTTTGTCTAATGTACACTACAACATATAAAAAATACATTTGTATGCAATGATAACCTTAACCACA
TTTACACCAAATTTAACCAAACAAACTCCACGACTAACTGTACGCTCACGAAGATACTGCCGAATGCCCTCCGCGCTAGCTCCGGCCCTGTGCAAGCTAC
CATGTCCTGTGTAAGCTGAGGGTCTTTTGGCGTCCGATTCTTCGAATAGTGATTCCGAGCATGCATTGTCAGGTTGTGGTTGTGGCAGCCCGATGTCTAA
CCTTTCGCCACCCAAGAGCTATTCGCAGTTGCAGCCACGCGTACATTGACCTTAGCATTGCAAATCGTTGGGCAAATTCTACTGTGCTTTCGTCCCCATT
CCCACGGGCCTTGTAGGATTGAGAATGGTACACGTGTACGTCTTCGAACCCCCCCCCCCCCTTCCCCCTCATCGGTCTAGAAGCAGCACCTTTTCCCTCG
CGCTTGCACTTGCCGGTCGCACTGTTGGCCTTCCACAAGTTTTCCATCTGCTTGTTCCGGACTGCTATGGAGTTACTTTCTCTTTTAGAGAACGGTTGGA
ACGCTCTGCAGTGGAGCTGATGAAGTTCCTCTTCAAACTCGTCCCATGTCTTGCACGTCCTATTGAATCCGTCCAAATTGATCGACACTGCAATCTCTGC
TGGTCGGTCAAATGTTCGGTCCGTATTCACCGAGCCGTCTGAGCTTGGTGAGATTTTGGTGACGTACCAAACGTAGGCTCAGCCACAAATGCACCTCTCG
CTTCGGCACTGCCCAGCATGCCTCCTCGGCATTGCTGCCAGCTCGTCCATTGACCCCGTCTTTTTATCCACGTCGAAGTCAGCTCCAGACGAACAGTCTT
CATTGCTTGCGGCAGCCTGAGTCGCCGGAACATCCTCAAAGTCGGAGTCGGCTGAGTTGTTCGACGATGGCTGGTCGGCCGCCATGTGAAGCGCCTAAAA
CGCCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
CTGCCAGTCGATGCGAAACGCGCACTTTGTTTTTGTTGTTATTGTTTTGTTAAGAAAAAAGTCAGATTTTCCCGCCCGAAAGTAATTATCTTCGCAGAAT
ACACAGTTTCACCCGAACCACGTAAAATTAATAGCCCCGCAAAACACTGATACTATTCGTATGGACTCGAACATCTGATTAATGTCGCAGCAAACTTAAA
GTTTGGATATAATAGAAAATAGAATAACATTTTTTATAATGCTACGATACAACGTTTATTTATAAAGAACTGTGAGAGCGGTTTTTTTTTTAGATATTTA
TGACTGGAGTACTAAATTTCGTATCAAACGGCTTACAACACTCTAACCCACTGGAAACGTGGACAATTAACATGAAGCATAATAACTGAGATAGATAGAA
CTGACAGTATCAGTCTGTCAGTTCTATAAAACCTATGTTAATATTGTTAGGGCAAGAAGCTATCGCTTAACATTTGTAAATCAAGTGTATAGTGCGATGA
ATGAGAGAAATGTTGTAATGTTTTGGTATAGTTATACCAAGGAGGCTCTGATTGTAGAAAACACATTATATCTATAGATTGCACTGATCAACTCGGGGAA
CTTTGACTTGATAGCCATTGTTATAATGATATACACAATTTGAAGGCTTCAATGAAATAAATGGTCTAAATGAACTATTTAAAAGAAATGGGCTGAAGGA
AATATTTAAGACTAATGGATAAACAAATGGAGGTTTAAAAATGCCATAATACCGCCAAAGTGTAGCGGAGGCGGGAAAGACCTTACAAATTTCGACTAAA
CATGAATTGTCGCTGTATAGCGGCGGCGCTCGGTTAGTGTATAATAACTATAATTGGATGGCAAGCGCTTCTCGAGTTTGTCAATTGGGATGCTGCATAG
TACTAAAGTTTGGGTCTCGTAGGTGTCAGCCAGACTAGATTGATCTTACATTGAAGGCTACAACTGGTTTTGCAACACTGACGTCCGCTGTCTGGCTTGC
CGACAACATTCAGTTCTCGGTTCTCATGATCTAATGTGCAGGCTCAATTTGTGGTCATCAACCACAACAGTGCATGGATTTGGCTGTAGTTCGATGGATT
TGTCCCATGTGGCTTTAATCTACGTCGAATATTGTTGTGTTGTTAGTCATTCCGCATCGTTGGATGTGGACGGATTCCGACGTTATACGTCTGATTGGTT
TTGTGTTTAGGACGATGGTTATTTTAAGATGTTACCCCAGATGATGAGCATCGCGGTGATGATATTTCCGAGCTGTTCATGCATCAATGATGAATCACTC
TGTTAAGGAGGAGTATCTCACAACTGAGATCGTAGCTTCTTCTCCTCCAAAGTTGCTGTGCAAACTTCACACAAGGTTGTAGGTGCCAGTAGCAATGTGG
TGGAGTGGGATTCACAAAATCGCGTTGCGATCCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN