Description :
From Genome Similarity Track
Location :
contig_202:23125- 24384
Transcript NameFunction/comments
g472.t1hypothetical protein

Sequence
1259 bases(100 bases per row)
GGGCAACGATAATCCTCCGGCAACAGCGACCGCTGCAGTTTGTTGAAAGCAAACTGGCGCTTGCCCGTGTTCTTGAGCGCGTTCTCGATACGCACACCGT
GGCTACGCATTACAGAAACCGTGGCAGGAACGCGGTGTTCCGGCAGGTCGTGATGGCGCTGCAAGATACGTACCTGCTCTAATGTCACAGACATAGCTGT
ACGATCCTTGGCACTCTTGCACACCGTGACACGTCCACCACCAAGCTCCCGACATAGGTCGGAAGACCGCTTCAAAATCTCAGTGCGCTTCGTCTTGACC
AGACTCTGCGCAGCTTCGTTGATACATGCTTCAAGACCGCGCAGCTCCTGTGTTACTTCATCTTGCGTGAGATGCAGAGGTGATGCGATTGTTGAGTCCG
TTGACATGGCCTTGTAGCGCTGCGAGCCGGTACGACCACGGCTGGAGGATGATAAACCACTCAAGCCGCTGGCAGGCATAGCTACCACAAGTCGACGGTA
CTTCTCGCAAAACGTCTTCAGAGGCTTTAGACTGCGGAAGTTGATGATATCCTGCAGCTCCGTCTTCGCACGTTCCGTGTTATTGGCAATCGTCTGCATT
TCATTGATACCCTGCGAGAACAGCACAGGCGTCACATGAATCTCACCGCCAGCAGCCAGCCGCTCGGGCAGCTCCACTTCGCTGGTGGCGACTTGCACTG
TCACGATGTACTTGATGTGAGATCGCTTCGCACCCGTCTTGTTCGAGACAGTGACCTTCACAACGCCGGCCTCGTCAGCCACATCTTTGCGGCGTGACAT
GCGGAACGAGAAACGGTTCATGGGCTTATCACGAACATCTTGAATCACAAACGCCACACAGCTCAAATGTTCCACCGAGCCCGCCATGTCTTCCAACATG
CCGATTTCCTTGCCGTGTGTGGACAACAGTGACTCAACCTGGAAAAGGAAACCCAGGAACTGGCGCAGCATATCTTCGCCACGAACGACGTCCGGGTTCT
GAATTGCAACCTCCACTTTTCGCACGAAGCTACATGTGAGCGACGCCATCGCTTGGGCAAACGCGCAGTCCATACGCAGCTGCAAGTCCCACTTGAGATC
GTCGTATTCACGAACTTCCTCAGGCCACTTAGACAGGTCAAGGTCGGCTTCTGCGATCTTGGCCTCCATTTTTTTGCGTCTGTTCTGGTAGGACAGAATG
CCGCCCTTATTGAATTTGATACGTGTGCTGCTGGTGCGCCAACAGTCGTGAAGTCGTAC