Description :
From Genome Similarity Track
Location :
Scaffold_148:23116- 26630
Transcript NameFunction/comments
g14637.t1RAW35804.1 hypothetical protein PC110_g7933 [Phytophthora cactorum
g14638.t1hypothetical protein
g14639.t1hypothetical protein
g14640.t1hypothetical protein

Sequence
3514 bases(100 bases per row)
GCTCATGGCGACGTCTTTTTTGCTAATGGGACTACCGGTATCCTAGCGGTTTTGTTTGTTGTGTGGTGGACACAACGTCGGACTTAGCAGTGACTCAGCT
TTTCGTTGTGACATTGCAGAGCTGTTGGAGCTACATGCGGCGCGGGAGCTGTCGACGTCATGGCTGAGCGTACGTGGAGCGTGCATACCTTGTGTTACTA
TGCTGTGTAGATACAAGAGCGGGTTATGTAGTTGTTGCGGACGCTGTAGCCCCCAGCGCGCTCTACTCGTGTCGCTATCGCCTGTCAAAGTGGACTAACT
TGTGTTTTCTGACTCTGCAGGTGTTCGCCAGTGCCCCCGTGGCAAACGGACGCGGGTGCTGCGCCATCTGTACTTCACCAGTGGACGTCACTATTGGGAG
GTGCTGGTGGAGCGCGTGGCGGATCCACGCAGTGTTTTTGTGGGCGTGGCGCCGTCCGAAAAGTTCGAGACTGGGGCGACAGAGCAAACGGTCGGATACG
CCGCCACAGGCGAGATCCTGCACAGCGGGGAGGAGGTCTGCAGAGCGCAGGCTTTCGCGGTAGGGGATACAGTTGGAGTGTACCTGGATATGAACGCACA
GCAAGTGGCGTTCTTCCTGAACGACGAGGCGCAGCTGGATCCGAGTGAAGGTGACCAAGTGACGACCGCCGGTGGAGAGCACGGCGAGAGGACGGACGGA
CCTTTGATGAATGGCGACCCGGACTTAGAGATGAAGGCTCCTGTGTGTGCTGTGGATGCCAGGAGAGTCGCGTGGTATTCTTTCCACTCCCGTGCCATGT
TCGCTGCAGTTGGGTGCTCATCGAGGGCTGACAGTCTGGCCGTAGTCGGAGCTGACGTGCCCGATGGCTATCGATAGGAGTTTCGTGTCCTTAAGGCCGG
TTTGTTATTTAATCACGGGGTACGGTCTTGCTGAGCTGTATCTGCTACACGCAGTCTGAACTTCTCGCCCCGCCGTAGACGCTGTGTTTGACGTACATCA
TGCCCTCCAGTGGTCCTCTCCAGTGCCAAGATCCAGCGGGTGTCCGCGCGCATCGAGTGCAATCGTAATGGTGTTTGTAGGCTGCGAGCATCCAGTCGTT
GCAGTCACGGCCTTACAGCCGCCAGACTGGTCATGCCAGCCAGATCCACCATGTACACATCGATGGTATTTCCCTTGCCTAGAGCCTCCGTGACCTCCTC
GCCAATGGCCAAATAGGTCTGCGGAATGGACGTCCGCGTGGCCGTTTCCGGCGTCTACTTGACTTCATACTTTGATTCCTGAGCTGATTTCATTGCGGGA
AAGTTGCGAGTACGACGGCGAAAAAGCCATCACCCCGATATGAAATACGGGAGCGGGGTACTGCTGTGCAAAGTAGTCCCGTTCCAGCTCGCTCACCTTC
CTTGGACAGCGAGTGGGTCAGCTCTTCCTTCGTATGTACTTTGTTGCTCGCGCCCGACAATTGCAGCTCCCTCACGTACCCCATGAGGCTGTACACGCTT
GCGGCTTGGACGCCACCAGCTCATTACTGCGCAGTTGACGCAGCTGTCAATGCGAAACTGCGGCTCGCGCGCATTGTTGAACGCCGAGGGGCACGTTCTC
CTCTTCGTCGTACCGTGGGGGATTGTTCACAAACACGTTCTCCGAGTTGTTGGCGCTGGATCCCGCGCGTCTCCCCGTCAGATCCATCAGCACTCTTTGT
GCAGCACTAATGCCTCCGTCCTCGTCGAGCGTAGGCTTGGCCATCAGCTTCTTGCTTGGTGCGCGAGGTATGTAGATACATTATGTGTAAAACACCACTG
TGCAGCAAAATCGGGTGAAAAACTGGAGGTGGGGGCACCGATGCCGGGGTTCAAGCCGCTCCTGCCGCTAACTGCACCGCATGCTGCAGATCGAGGCGCG
CAACGAGGACGCGGTCAAGTTCAGCTTCGGCACGTTCCGGGTGTTGCCTGACTGACGCCATCAGCATGGGCAAGACGGCCATGAAGCTGGCCGAGCGAGT
CCAGAGACTACGCGGTCGTCGCCGACCTGCTCGTGGCGGCGTAGCATCTGCTGGCACAGTGAAAGCTCAAGGCGAACAAGTACGCCAAGGCCGGAGAGAT
TGACGTGATGTTGAGCGTGCACCATTACCTGGAAAAGGTGGAGAATCCGGTGGACAGCGCCGACATCTCCAAACGAATGCTTGTACTCGTGGGCGTGGAG
GAAGCCGTCAAGTCCAGGGACAACTTGCAGATGTGGGAAGCTGTATCCGATGGAGATAAAGTACCACGGCGAACCGCTGCACGTGGAGCTCGTTGTGCCG
CAGGAGTATGAGGAAGCGGCTAAGCTCGTGCACAAGGCGTTCTGCAACCCGCTGTGGGTCAAGCCATTGCATTTGCCATACAAGCCGTGATTTTCGAGGA
GGTGCAGGACCTGGTGCTGCCTGGAAAGAGCGCCAGTGGCTGTTTTATTCAGCTCCAAGTGCGGTTGATTTACGGCAACGCCGTACGCGAACAATCAGCT
GCTGGGGTGGAAGCACCTACGATTGCTGTCGCATGATCCTGCGTTTGACGAGATCAAGTGGAAGATCTATCTACGCAACTTGCGCAAATGAAACAGCAAC
CCATCACGGACTAGATCAAGGTGGACGAAACGTACATCTTTATCAAGCTAGGCCCGAAGGAGTTGTTGTTTACACAGTCGAGCGTGCTCTGGCTGCGAAA
CAGAGCGAGTATGAGGTGTTAGCTCTTGGAGACATCAACATGTTGGCAGCTGAAGGAAAGGCGTCGCCGAGGAAGTACCAGTGAGGATGCGCTGTCGGGA
ATGCTGTGGACAGAGCAGTACAGACCTGCTCGCCAGAGTTGTGTGCACGCCGGCATCTTTAACCGGATACTCGACTGCGGTCGCAAGATGGAACTTCGGA
TAACTCACACCAGTGCTCGTCAAGATTAAGACCCTCTGAGAGGTGTTTCGTGATGAAAACTACCATTTGAACCGGCAGCTGGCTGTAGCGCCCAAGCGCA
AATGGAAGTGGATGTGATTGAGGCTGCGACCACGAATATAGCAGAAATCTGCAAAGTTATCTGCAAGTAACGCCAAAGTCGATCAGCGCTTCGAAGACGT
CGAATGATCGGTGCTGAGCAAGTTTTATCGACGGGGGTGGAGAGAGTAAAGATGGTTTCCGAATGTTGTCTCACTTGACGATGAGGGGGAATGAAGACTG
CAGCTGGCTGAGCTCACCAAGATTGGCTACCGATCGACTTTCGGGGCACCTAGGCTCTGATGCTCCGGGTACTGCGAAGTAGGAGCCGGAGTCGAGTCCT
TCGTGGTCCGAGTTTCTCCGTTTCCGTGGTAGTCGGAGCAGGAATCGGCCTACCAGTCCCGGTCGCAGCAGGCGTAGGAGCTTCAGTCTCCGTCGTGGTC
GCCATGCCCCGAGCCCAGGCGTATCCCATCTTGTAGGTTGAAGATATGTGTTTCCACAGGTTCGTTTTGAATTCGCTCCGCGCGCGTACTTTCTCGCTTT
TCCCGCCCAAAAGG