Description :
From Genome Similarity Track
Location :
Scaffold_275:23113- 25343
Sequence
2230 bases(100 bases per row)
ATGAAACACTAGAATATCTCATGGCAACATTGGTTTTTCCACTGTTAGGAAACGCATACGGCTCAACATCGGTCTGAAGCGAGAGGGCGTAAGAGACGAA
TTTAAGACGAAATCGTTTTTAATACGCGGAGAAGTTGTACTTCTCGAAGAAAGATAGCCATTTCTCCAGCCGTTGCTATAGATGCGACTTATTCCAGCCG
TAATCAATGAGCAAGATCGGTCGAGAGTCTGTCCATTAACAGATTGACCGTGAACTATACCACTACATCCTTCACGGCAAAAAGTTCTTTTCCTTTACTA
ATTAGTTACGTTCAGCTAGTTGGAGATAACGGGAATGAAAACAGACGACGCTCTCCGCGCCGTCTATGTCATACTGCATTAGTGCACAGCCGATTGCAAA
GTCTCTTGAACCGAAGACCACATAATATAGTATATCGTGATCTTCGATAGCCAATACTGGCGATTGTAATAAGTTTATTTCAATATTGTCAGACTAGCGC
TGACAATCAAATCTTTAATACCATCGCCCACTTTGCATTAAATAACATCGAGAGATGAGTTGTCATATCGGTGTAGGTGCACAAGCACTTTTTTCCAGTT
GTTGATCGCCTAAATCTTTTCCGGATCTGGGCATACGCTGTTTGTACCGACTATTCATCAAGTAGTGAAATTGAATTAGCTGCACGTATGCAGATATAGA
GTTTGGCTTCCGATTTATGCTCTCGATTATTACAAAAACCCTCAAAATGTGGTGTCGATGAACCCCCACGTTCGTCTTCCTTTACATGGACCGACTATAA
GTGAACACACCGTCGAAGCATCTCGGTGTGAATTCTTGCACCGGTGTCAAAATATTTGTTACAAATATGTATAATGTGTAAGGGACGTTAAGGAGACCTT
GTAACATCACTAAGCACGGGAGGTTCTCGCTGCTCTGTATGAGATATACGGTTCATACATAAGGATCTGATAGAATTTATGTATCAGATCCATGGACGAA
AAGATAATACCATTCGATTAATGGTTGAAACTGACATCCTTCCTTGGTATCGGCGTCTAAGCCGTTACCGTTGCATCATTAAACTTGTTAAACGCATTCA
CCATCCTCTATCCACCTGTGGCCTTGCGCACTCAAAAATGTCGGATTGCTATGTGGGGAATCCTCCAAAATGTTTGCTGCTTGGCGGTTAAGCAACGAAG
TAATCGATCGCCCTGACTTGCTCGCGAGACAGTGAATACTTCGTCATGGTACAATATTGAGCCTGGTTTCATGTCGATCTCGTAATGATCCTCAGGCAAA
TCGCATGGTCGTTTTGAAAACCATCCCTGATTTCTACCGACGCATCGTAAAGCGAATTTTTCTTGAGCGACTCCCACGATTGGGATGTATACCGCTTGAT
CCGGGTCTTTTTATCGAGGACACTTTCGTCCATCGATGAAAAACTGAGGACTCGTTCTTTCTCAGCGAATGGAATTGCCGATTTTATATCGTGAAAGTAC
TTGCTTTAGTGACGAGTATGCCAATCTACTTGACACTCATCTACGCAGACTACAAACGAATCGAGCGTTGGTCATTAAGTGATCTCCAAAGTTTACTTCA
GAGGCACAATCAGATGAAAAGTATAAAGATTACGTTTGATCCGTATAATTAAGACATCCAATATATCAGTTTTGTGCTGGGGTCTTATTCATCAGGCTCA
TGGGGACTCAATTCCTTAGTAATTATTTTATCGGGAAATACTCCCTAAATTTCCTTTGACTATGGTTGCTAGACCGCAGCGGGACCCTCTACATTTGACT
CTCCTGCCAACCTAGGATTATTTTGTCTTCCGTCATGGTGAATTGGTATAATTATCGTGGATGCTGCTCTCTTGGTGAAAGTTCATGTCCCTGTCCCCCC
AGCTTATTCGAGTAGTGGAAATTTGGCTCTGCTTGTGTTTCAACAGAGGAGCCAACAGCTAACTTTATAGTGTAAACAAGTAACGCAATGAGTTCTTGTG
CAGTAGAACTAACAAAAGAGCCTTAAGTGAGTCCGTAACAATCTTTTGCTGTACATTCACACGCTTGTGGACGCTCCAATATGTTCATTATATTGCTATC
TAATGAGGAAGAAACACCTGTCTAGACTGTTCGGCGCTACCAGCTGAGTTGTTACCCGTACCTATTGAGTCACAGTAAACAAAGAATGATATTAATTTTT
ACATTTGAGTCAAATACGATGGAATCATGT