Description :
From Genome Similarity Track
Location :
Scaffold_65:231088- 238098
Transcript NameFunction/comments
Hyaar_Emoy2807555myosinlike protein putative
Hyaar_Emoy2807556NADPH:adrenodoxin oxidoreductase, putative
Hyaar_Emoy2807557NADPH:adrenodoxin oxidoreductase, putative
Hyaar_Emoy2807558cell-surface large adhesin

Sequence
7010 bases(100 bases per row)
ATGACCGGAGCAGCATAGTGCTTGATAAGAAACTCGGTACGAGACGTGCGGGGAAACTCAATCACGTGTGTCATGTCATCCTTGTGCAGAGATGTCACCT
TGGACATGAACGACTCCTCGCTACCCTTCGGTCGCATCACCTCTTCGTTCAATAAGGAAATAATACCCATGCGCGACTCAATCACGGTCAGCACGTCTTG
GTTGTCCGCATACTCAATGTGGTCCCACACGATACCTTCTTCCTCATACTCAATCTGGACAGTCTTGAACACATCCTGAGTAAACTTCTGTTGCAACTTT
TCGTTAGCGTAATTAATGCAAAACTGCTCGAACGAGTTGTGCTTGAAATGCTCGAAACCGAAAATATCGAGCACACCGACGTGATTCGACATATTCTTAT
CATCAGCGAGAGAGTGATTGATTGTCGTCACGAGCCAGTCGAACACATTCGAGTAAATAGCCTTTGCCAGGGCATCACGACAGTTCATCGCCAGCTCTTT
CTTCAGTGGCACACTGTACACATCGTTCACCGCGCGCATGGTACGCGAACACAGCGCAGTCTCAAGTGCTTCCCATGTGACGCCCAGCATCGCAGTCGCC
GAGATCGCGCCACCATCACCCACAGCGATATTCGATTTCTCATCGTCCGATGCGTCGGATAGCAACTGCACTTCACCAAGGTGCAGCACGCCCGCCAGCA
CTTCAAACAGTGGCTGCTGCTCTTCACGTGAGAGTCCCACGAGCGCCAGTGCCTCTCGTGTCTTGATAAAGTGCTTCTCGTCCGACAATCCTTCAATCTT
TTGCGCCGTGTTGTTGCCCGTGTACACATAATGTTTCGTCGAGTCGAGCTGGAGCTCTGCCGCCATGTCGGGCGAGTCCAAGAGCTGGTAAAAGATATGG
TAATTGCGCTCCGGGGCTTCGTGCTGGATCACACGTGTCTTCTCCAAGAGATACGTGCGACACTTGGCGCCCACGAGCGTGCCCCTCTGGTCAAACTGGA
GCTGTGTAAACTTGCCGAATCGACTCGAGTTGTCGTTGCGGACGGTCTTGGCATTGCCAAACGACTCGAGCAGTGGATTGACTTCTATAATGCGCTTGAT
CGTCGAGTTGTTCATGCCGCCCGCGATCGTCGCGAGGTGGTTCATGAGGATCTTGGTCGTCTCGGTCTTGCCCGCTCCCGACTCGCCACTCACGAGGATC
GACTGGTTCCACTCGGAGCGTCGCATATTGTCATAAGCAGCGACAGATGTCGCATACACGTGGGGCGGGAGCTCTTCCTTGGGTTGATTCAAGTACCGTC
GGTGCTGCTCCTCGGCGTAGAGCTCCGGGAGCCACTTGTACGGGTTAATGGCGATACAAATGTCGCCCGTATACGTATACGGGAGCTCGCATAAAAAGCG
CTTTTTAATGTTGTACAGAATCGCCGCCTCGTGCAGGTAATTGAGCGTAATCATGTCTTCAATGCCCTCAGACCCGACGTTCTCGTTCTGATACGGCAGC
GTCTCGAGCTCGTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGCCAGCATGTCCACGCAGCGCTCTTCCGTGCCGCCATCCGGGAGCTCCACTCTGCAGT
AGATCTTGCGCGTCTTGCCGTCGCCCGAGTTCTCGTCCCGCAGGACTTGGGCGGCCAGCCACACGTGCGTCTCGTCGGGGACGAAGCACTTGGCACCGAC
GACCATCTGGAGGTCGTTCATCGTGTGGGAGTGGAAGTGGTCGCAAGGGGGAGAGCAGGAGAAGAAGAGGAAGAGGGAGGAGAGGGGGAGAGAGAGGAGA
GGGGGGGCGAAAGCGGAATGCCGAGGCGGCGGATTAGATAGATATACCGGTAGATCAAGTGGGTTGCCAAGTAGCAACGGATGGACTGGAGGTTAGACTG
TGGACTCGGATTGCGCAACCAGCTGGTACGGACAGCGCCGGGACGACGCAGCTGCTGCGAGAAGATTTGAAGGCGAAGCTCAAGCTGAGACTGGAGGTTG
GTTCAAAGGCTGGACTGGACTGAACTATGCTATGACTCTGTATGAGAGTGCCACGTTTACGTTGATGCGTCGCGTCTCTTTAGACTACTGAAATTGCGGC
TTGTGCAATGCGTGACACGTATTCTAGTGAGTGCACTTTGTAAACGTCTTTTAGTACCATTGAGGGTAACAATGAACGTCCTTTTGACAGATAGTGAAAA
GCAACCTGGTTTCCCATTGGTCTTTTTCTGCAACGAACATGATTTATCGTGAGGTAAGCAAACTTGTCGAACCGCATACCGGTTAGTGCACACTGTGGGA
CAACCTACCGGTATGTAGCAAATACCCTACATCAATCCGAACGACATGCTGCACCGCTATACCCGGCACTTGACGCGTCGTCAGCGCGTCTCGAGCGCTC
GTCAAGTGCGCGGCTTTAGCCTTCACGTCTCTTCTGATGCTCCTCTTCGTCGTGTGTGTGTAGTTGGATCAGGACCCGCAGGTTTCTACGTCACCAAGTA
CCTGCTCAAGCAGCACAGAGGCGTACGCGTCAATATGCTCGAGGCGCTACCGACGCCGTTCGGTCTCGTGCGCTCAGGCGTTGCCCCGGATCATCCAGAA
GTGAAAAGTGTCATGAACGACTTTGAGCTCGTGGCTGGTGATGACCGGTTTGGTTTTCTGGGGAACGTCTGCGTGGGCAAAGACGTGACGCTTGCTGAGC
TGCAGCGCTACTACCACGCTGTGATTCTGGCCTACGGCGCAGCAGAAGACAGGGAGCTGGGCATTCCAGGAGAGCAGCTAAAGGGCGTCCTGTCTGCTCG
TGCATTCGTGAACTGGTACAACGGTCATCCAGCGTTTCGTGGACTGACGCCAGACTTGAAGCGGACGGAGACGGCGGTTATCATTGGTCAAGGCAATGTA
GCTGTTGATTGCGCTCGCCTTCTCACAAAGAACGTGGACGAACTGGCTAGGACAGACATTGCGGCTCACGCGGTGCAGGTGCTGCGCAATAGTAGTATTC
AGAAGGTGTTCGTGGTCGGACGACGAGGCAGTGCGCAGGCGGCGTTTACGATGAAGGAGATTCGTGAGCTGACTAAGCTGGATGGTGTTGCGTGTGTTGT
CGATCCAGATGATCTGAAGCGAAGCTTTACGCCCGCATCCGAGCAGGAAATCCAGGACCAGCGAGCTCGCAAACGCATGGAAGAATTGCTGAGTAGAGCC
GCAGAGCAGTTTGAATGCACTCAAAACGCCAAGCGTGTTGTGCAACTCAAGTTTTTGAGCTCACCAGCGGAAATCATCGCAGACGAGAATGACCCGACTC
GAGTGGGAGCCATTCGTCTGGAGAAAACGAAACTAGAGGGCAAGCCCAACCGACAGCGTGCTGTAGGAACCGGAGTGTATGAAGATATTCCATGCAGCCT
TGTGTTGCGCAGTATCGGATACAAGTCACTGCCGATTGAGGCCGGTATCCCATTTGACACCCGTCGCCATGTGATTTCAAACGAGCGAGGTCGCGTTGTT
TCTACACTCAGCAGTGGTGAGAAGAAGTCTATGGTAGGCTTGTATTGCACCGGCTGGGTGAAGCGTGGCCCCGCTGGCATTATTGGCAGCAATATTGTCG
ATGCACGGGAGACGGTAGGGTGCATTATGGAAGACTTTGCTGCTGGGAACTTTCTTCACAGCGACGGTAACGCTGGTAACGACTTGGGTGAAGTGGAGGC
TGTGGAAATGCTAGTTAAAAAGCGCTATCCTGACAAACAGCTCGTCAAATGGGCTGACTATGTGCGCATCAGCGCTGAAGAGACTCTACGGGGTCAAGCC
GTCGGGAAGCCGCGCGAGAAGATCACATCCGTGACAGAGATGCTCGCGATCGCAAAAAGTGCAACGAAGCAGCTCAGTGCCGAAGCGTAGTACCGAAGCG
TACCACGTTTGTCGGTCATTTGCATTCCTGACGTATCGTCATTTGCCTTTTTTGCTTAGGCAGTGCAAGTAGAACTGCCATATTACCGAAATTGCGATCT
CACTGCGCTTTTGTTTTCGACGAGCATTTGCTTGAGTCTTGTCTGAGCTACAAAGCATGTCAAAGACGAAGGTTTTACTACAGAGTACTATTTACCGCGA
AATGCCGAGGGAAGCATGACGAATGAAGATCACGCGCCTCTTGTATGAACAGTATCGCCAGACGGCGGCACGTTTTCGCTTCTGCTCAATTCGTGCAGAT
TACTTGTACGTTGTTGTTGTGGTCTAGTACACAATGCGTCAGCAGGAATGCAAAAAAAATAAGTGAATACGTGATTGTGACCAACGTCTCTCTTGTGCTA
GCATATCTGTTGTACCCGATCTCAAACGCCCGTGACTTTCGCCGCTACGTTATGAAGCAAAATTGTCAACCTGTGCTTAGTCGTGCACCAACCCTGTCAC
TTTAGGGTGTGTGTCTGGTAAGTCTGCGCTAGAAGAAGTATTCGATGCCCTTGGTCTTCATCTCAACTGCTAGCATGAAGGGCAACACATTGATCCTTAT
TCGACCTAGCACAATACAATAGTTAGACCTGTAGCGAGTTCTAACCTTTCGGCATCAACACCATGCCCATAAAGCTTGGTGACGACTAGATTATTGGTTT
CATCTTCAGCTGCCACCTCTTGTCGTATTCGGCTTTTCTAGTGCAAGTACACTTACGCGGCCATTTACTACGCTGTAAATGTACCGCTCATACGTTTTGC
ACGACGTTGTAAGTAGCGTCAGAGTAGCAATCTCGATGTCAATGTTGGGACTGTTCTTTTCTGTAGTCATAGATATTCAAACGCAGCATTTGAAGCTGCC
ACCGTACTGTCTTTCTATCGAGTCAATAGTTGCTAGATTGCAGACGTCAAAGCGAATCCAAGGAGGCTACCAGAAAAAGCAGCTGCTACCGCTACGAGGA
ATACTTCCTCAAACAACTCGTCCGTCTTAATATATTCACTCTTACATCATTCCTCGGAGACGCTAGTGCTATACCTTTTCACACCTCTTGATGTAACAGG
TGTGAAAAGGTATAGCACTAGCATCAGCCATATAAAAATCACGAGTGTAGGGATTGTACTGCTCACTGTAACGAGCTGGCTTACTTAAAATCTGCCATTT
ACCTATGATATTTTGAGCCCATAAGTAGCAAGTATCGCTCTTGACAGCTTCCGCTGGACTTCACGTTCACAAGCTCTGCACTTTTGTTGTGCGAAAATCT
CGCCGGCTCTGGTGAGACGCTTGCTACTAGTGTTGAAAACAAATCAATTTTACAGCGTCCTCGGAGGGAGTTAGTAGGGGAGACTTTAGAAAAACATAAG
TGTTCGGGGTTTGTGTCTGGATCGTACCCAAGGAAAGTCTGCACCGTACCCAGATCCCATGCCCACTGATTTTAGGGATTAAATCGATTGTAAAAATAAT
ATTATTCAAACTATTCAGCGAAGGGTAAAGTAATAGATCTTGCAGGTTTTAAGTGGATGGATCCCGAGCGAATAACATGTTTTCGTGTCTTCGCTCGCAC
AGCTCACGAAGACACGAAAACATGTTATTCGCTATAAGAATCCCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCGGTAGCAAAAAATTGCCGTCTCTCGATGTATCGCCGCCAAGAAGACAAGTCAGCAGTCATGGGAATGGCTTTATTGAGCGCGTTTCAAG
CGCCTCTTCGGCAAGAGGGAGATGAACATCCTCATGGTCGGTCTTAACGCTGCCGGTTTTACTCGATCTTGTACAAGCTCAAGCTAGAAGAAGTGGTCAC
GACCGTCCCAACTATCGGTACGTGAAGAGATGTCTATAGCTGCATTACGTAGAGCATAGAACTGCTTGCGCTCGTGCTTGTTACTCTGTTTTCTGTATCT
GATGGAGGACAGCAGTCTAACTGAGTTTGTGGCTCTGACTCGGTGGTAGGATTTAACGTCGTGACGGTGGAGTACAAAAAACATTAGCTTCGAGGTGCAA
GACGTCGGTGGACAGGACAAGATCCGTCCGCTGTGGCACCACTACTGTAAGAACACACGGAGCCTGATCTTTGTGGTCGACATAACGGTGGCGATCGTGT
GGATGCTGAACGAGGACGAGCTGCTCCGCATGGTAAACGAGTAAATACTGCACCGCATGCTGAACAAGGACGAGCTGCTCCGCATGGTAAACGAGTAAAT
ACTGCACCGCATGCTGAACAAGGACGAGCTGCTCCGCATGGTAAACGAGTAAATACTGCACCGCATGCTGAACAAGGACGAGCTGTGGGACTCAGTGCTG
CTGGTGTTTTCAAACAAGCAGGATCTTTCGAACGCCATGAGTGCGGCTGAAATGACGGACAAGCTGGGTCTGCACGGTCTGTGCCAGCAGTGATTTATCC
TGGTGTATCATGCCACGATGGGTGACGGGCTGTATGAAGGTCTGGATTGGCTCTTGCCTCTCCAGAAAAAGCGGCTGCCAATTGCTCTATGGCGCTCTAA
GGCGTTGCTGCCATGCCCCCGAGGAGTGAAGATGTGGGCACTATGCAAATGGTAATGGAGAGGACGGGAGGCCCTAACCGTGTAATCGTGCGTCCATTTC
TGTGAAGGTACTCGCACGTTCATTGCTTGGTGTCACGAAGTACGTACGTTCCCAACACATTGAATGGATCAGGACTTAAGTGAGATGTACAAAAAAGGCA
AAATATAATGACGATGCTGTAGCACGGCGCAAGATTGGTCACTTTGCTAATCGACCATCGTTCTTGTTTTGGATCGTGTGATGATATGTAGACCTTTGAC
TGAAAGAATG