Description :
From Genome Similarity Track
Location :
Scaffold_5:23102- 30119
Transcript NameFunction/comments
Physo_155477DEAD/DEAH box helicase domain containing protein
Physo_111357ribose-phosphate pyrophosphokinase family protein
Physo_128510CIPK8 (CBL-INTERACTING PROTEIN KINASE 8); kinase
Physo_108286Cobalamin synthesis protein/P47K

Sequence
7017 bases(100 bases per row)
GTTGGCGCTCTCCTCCTTGGCCTCCTCCTCGAACCAAATGATACGCTGCAGGTTAATGAAACGGCCCTTGTACTCCAGCAGATGCACGTCGCGCGCCAGG
TGCGACTCCCACCAGCTCTTGAGCTTCTGGGCGTTGCCGATGGTGGCGGACAGAGCCAAGAAGGGGCACGTCACAGCCTTGATGATGCGCTCCAGGGCGT
CGCCCTCGGGTCCGTTCAGGTCGTGGACCTCGTCGTACACGGCGTACTGGAAGTCGTAGCCGATCTCAACGAGCGTCGACTCAACGGCGCGCGGCGTACC
GACAGCGATGCGGAAACCAGGCGGCAGGAAGACCGTTCCTTCCGTGATGAGCGCCACGGATCCCTTGACCATGGCCTGGAAGAGCGCGGCAACCTGCCAC
GCCAGCGGGTCCGTGGGGACGATGAACAGCACCTTGCCACCGACGACCGACACGTACGAGGACAGCACCGTCTTGCCGGAACTCGTGGGCGCGCACACGA
TGACCGAGTGGTTCTGGTCGATGTGGCCCAGCACCGTGCGCTGCCAGTCGTCGAGGATGAACTTGTTCATGTGGTGCATGTTGAGCGGCGGCAGGCGGTC
CGACATCTCCGTGAGCTGCCACTCGATCAGGTCCTTGCCGGATAGGTAATCGTTGACCGTCTTGACGTACTTGCGGTACTTCTTGTGCACGGCGTTGAGC
TCGGCCTGCAGCTTGGCGTCCTCCTCCTCGTCCATCTTGCGCTGCTTCTCGTGCTTCTTGCGGCCGTCGGGGCCCAGTGCCGAGCGCTCGGGCATGAGCT
TGGTGCGCTGGATCTCCCAGAGCGTGTCCACGGCGTCCGTGAACTCCTTCTTCTTGCAGCAGTCGCGCAGGATCTCGTACAGCTGCTTGAGGCGGCCCGT
GGGCGTCACCATCTTCATGTCCAGCAGGTTCTTGGACTTCTTGACGTTGGCCAGCTTCTCCTCGTCCACCTTGCTCTGCTTCTGGGCCTTGTCCTTGGCC
AGCTGCATGCGGATCAGGTCCGCCTTCTTGAGCTTGCCACTGCCACCGGCGCCGCCCTTCTTGTCCTCCTTGGCGCCCTTCTTGTCCTTGGCCGCCTGGG
CCTGGGCCTGAGTCTGAGTCTGGGCCTGCGCCGCCGCGGCGGCCTCCTCCTCCTGCTCCTCCGGCCACAGGTTGCGCGGGTTGAAGGGGTTCGTGGGCGC
CAGGTCGCGCAGGATCACGGGCATGCGGTCGGGCCAGACCTTCTGCCAGTTGACGTCGTACATGTCCGACTTCTTGTCCCCCATGGCTGTCTAGGTGTCT
CGAGCTCTAAGCGCCACTTGGTGTTGCCTTGTTGCTGCCTGCGGGACTGCGCAGGGTTGCGGAGGGAACTGAGGCGGTCGTTTCGTGTTCGCACCAACCG
TTCGAGGGGCCCGGCCCCATCCCCCACATACAAACCGCAAGTCGACACATGTCGCAGTAGTATCTTCAGGTGGCCCACACGAAGTAGCTGCCACACTGTA
TTCATTAAGAACCTTCATATATCGGTAGACTACTATCATGCATAGCTGAGATGCTCAAATACGAATCAATAATAACTTTCAGTTTAGTTGTAACTATTCA
ATTGCATACGTCCTGAATAGCCGAATACAGGCGTGACCACGGAACACACTCGGCGTCGTGTTTCGCACACCACGCAACAATTGGCCGGGCCGAGACGAGT
ATTCACTTGCGGATTATCAGCCGACGCTCGCAATGGTGAGGGACGCCGCCTTTTGCTGCCGCTCGGCCTATCTGTGTATGGTCCTAAGGGTGTAGCTGGC
TAACGTTATGCTTCTGTGACGGCAGAACCGTCTCCGATCGCTGCGCAGCTCCACGCCGCTGGCGCTGGCCGCGGCGGGCGCCTTGGGTGTGCTGAGCGGC
GGCCTGACGTCGCAGTCGGCGCTGGCGGACGCGGGCCCCGCGGTGTCCAAGGGCAAGAAGGGCGAGTGGTACCCGAACACGACCACCAAGCACTGGCACT
TCTACAAGGGCAAGATGAACCCCAGCGCCGCCAAGTCCATGAAGCTCTTCAAGGTCGCGGACACGCCCATCGCCGACGAGATCGCCAACTACCTGGGCGT
CGAGCTCAACAACATGGAGGTCAAGAACTTCAACGACGGAGAGACCAGCATCGTCGTCAAGGAGAACGTGCGCGGCAAGCGCGTCTACATCGTGAGCTCC
ACCACCACGGTGGACCGGTGAGTCGTTGGTCGAGCTGCTGACAGCTAAGATCGTGGGGGCGAGGAGGCTGACGCTATTCTATCTACTGTGCCAGGTTGAT
GGAGCTGCTGCTGTCCATCTCGGCCATGCGCCGTGCTTCGGCCAAGAGCATTACGGCTGTAATCCCGTTCTACGGCTACGCACGCATGGATCTGATGCAC
AAGGGGCGCGAGCCGATTGCTGCCGCGGTACGACAACAGAATTGGCGCACAGCCCCGGATATGCATGAAATGTCGAGTACTGATGAATTTGCTATGTCTA
ATTTTGTAGGACATTGCTCGTATGCTGGAGACGATGGGCGTGGACCACGTCGTGTCCGTGGACCTTCATAGTGCGCAGATCGAAGGCTTCTTCAAGCCGC
AGATCCCGGTACGGCGGCGTTCGTTTTACTATGAACGTTTTTGTGCCCGCATATTTACCTCAATTTTTTTGTCGTCTTGAGTAGGTCGACAACCTCCAGG
CCTTCCCTGTCGGCGCTGTGTATTTCTCGGAGCAGCAGGGCCTCGATGACCCGATTGTTGTGGCGCCACACTCGGCCGCTGTGAACCGTGCCGCCATGTT
CCGTGATACGCTGTCGCGTACGATTGACGAGTTCGTTCCGCTGGCGTTTGTGATCCGCAAGCACCAGCTTGACGAAGACCAGCCTGGTGAGCTGGTCGGC
GACGTGAAGGGCAAGGACTGCATCGTCGTGGATACTTTGGTGGACACTGGCTCCACTCTGGTCAAGACCGCTAAGGTGCTGAAGGCTAACGGCGCCAAGA
CCGTGTCTGCCTTTGCTGTGCACGCCCGCTACTCTGCTCACGTACGTCGGAATACTGTTGGGTGTGTTACGATCTCGGTGCGTTGACGACTGACGTGTTA
CGAATCCCCTCCAGGCCATGCAAACGCTGCAGAACTGCAAGGAGCTGGACAAGCTGGTGACCACCAACACGATCCCCGTGCACATGAACTCGGACGAGGT
CTCGCCCAAGATCGTGACGCTGTCGGTGGCCCCGTTCATCGCCGAGGTCATTTCGTGCATCCACATGAAGAGCTCCATCATCCAGGTGTCCAAGACCAAG
TCGCAGTAGCAGCCGGACAGAGTACTTTGATCAGAGTCTTCTATTGGTCAAAACTAGTTTTCTCCAATGAACGTCCATTACAGTTCGATTTGTGTCCCAT
TTACACATCCCATTTCGCAACACGCGACTGAAAGCCAAGCAGAGCTCTCGACTGCACCGCTGGCGCCATGATGGCCGAGGACAAGAAGCCGCAGGAAGAG
CTGGAGTTCATCAGCGTCGAGCCAGAGGCGCGGCCGACCAGCGCCCCAGCGGCGAAAGACACGAGCGCCAAGGCGGCTGCCAGCCCCAAAGCCAGCGACA
AAGAGGCTCTGTACGTGGCAGCAGGAGAGAGGGTTCGACCTTTGTGATGATGTCTCTGACTAGATTCCTGTGCACTGAGCAGCCTCACGTCCATGCGGAA
GGTGGTGACGGGCGCCAAGCACCCGGTGGCGGCATTCTTCCACCTGTTCTTCAAGGTACGAGGCCGCCTCAAGCGAGGAGAGGAGAGAAGTCCTATCGAC
TGGCTAGTTCACCTGTACTAATGTTATGTTGCTACTGTTGTAGGGTCTGGCGCTGCTCCTGTATATGTTCGGCAGCATCTTCATCAGCAACTTTGTGTTC
ATCTTCGTGGTGTGCATTCTCCTGTTGGCCTTCGACTTCTGGACGGTCAAGGTTCGTGCATGCATGCCTGTCAACTTTAGATACGGATCGTTCGCCGTGC
GTCTGTTGACTGACTTCTATTGCTGCTGTGCTTCCGTTGCTTCGCTGCAGAATGTGACGGGGCGACTGCTCGTGGGCCTGCGCTGGTGGAACAAGATCAA
CGAGGACGGAACGAGCGAGTGGGTCTTCGAGTCGCACGAGGACATGACGGAGATCGACCCGCTGGACTCGCGCGTCTTCTGGACGGGGCTGTACGGCGCG
CCGGCAGTCTGGGTCATGCTGCTTATCATCGCCGTCCTCAAGTTCAACGTCGAGTGGGCGCTGATCGTGGTGGTCGCGGTGGCGCTGAGCGGCGCCAACA
TCATCGGCTACACGAGGTGCAAGAAGGACGCCAAGCAAAAGATGCAGTCGCTGATGTCCCAGGGAGCCCTGGGCGCCTTCAGCTCGTCAGCTGGCTCGTC
GATCATGTCGACGATTGGCGGTTTGGCCCTTGGTGGAGGTCTCGGCGGCGCTCTTGGTGGTGGAGCGACACAGAAGCCCACCAAAACCGAAGTTGTCGTC
TAAATTGCATTGTACCACTGGTGTTGTTGCCATGTCAGCGAAGAAGGGAGACGCCATGTTTTGCGTCACTAACATCAACATGGCGGAATGAGCAATAGTC
AATAGCGTTTCGTATGTGTATTCTCCCGGGAACACGAAAGATGAAAAGAGAAATCCTAGAGAGGCCAACAGCGGGCTCTCCTCGTCAGGACGAACCATAC
TTGCTACCGTTTCAAGCCAAACAGCCCTCAACTGCTGCCAGCCGCAATCAGATCCTTCATCTGCTCGTTCAACTGCGTGTAGAACTTGTGGTACTCGAAG
ATATCACCCTTGCCACGACGCACCTCCACCAAGTGGAGGCTGTCTGCGAGCATGAAGATCTGGATCACAACGCCGACGGCGCCCTTGGGTGTCTGCAACA
CCGCCTTCACCTTGGACGAGTTCTCCACGTTGATCTCGCAGTGGAGACTCTCCAAGTGGCCCGTCAGGCGAGTCATGATGCTCGCCGCCGGGATGGTTGA
CGTGAACTGCGTCGACCGTTTCACTCGCTTCTCGTCATTGCTCTGGAACATGCGGTTCAGAGCCATGCCGCCGCACATGTTGATGAGGTCGAATGCGTTC
ATCACCTTCAGACCGCCGTCCGGCTTCTCCTTCTTGCCCGAGTTAATCTCGTCCTGGTGCTCCAGGATAGCTGCGTCCAGATCGGCCTGGCTCGGCTTAA
TAGTCATGTGGTCAACGGGGCTCGGAACCGGAGCAGCCGCCAACTCCGCGCTAATCGTGCCCGGTCCAGCGGCCGGGGCCACCTGCTCGTCCGAGCCGTT
AGCGTTCACAAACCACTCGTCGCGCAGGATCTCCTTGATGGTAATACGCGTCTCCGGATCAGGCACCAGAATGCGGTTCAGCAGCGCCTTAACGCGCGGA
GTGAACCAGCTTGGGTACGAGAACTCGGCCTTCTGGATCTTGCGGAACAGCGCCGACATGGTCGGTTCATCGAACGGCAGGAATCCAGCCAGCAGCACAT
ACAGGATAACGCCCATGGACCACACATCAGCAGCGCGGCCGTCGTAGCCCTTGTCGGCCAGGACTTCAGGAGCCACGTAGTTGGGCGTGCCGCACGTCGT
GTGCAGCAGTGAAGCGCGAGAGCTCTCGGGGCCGTCCGGGCCGCCGCCCTCGTACAGCGCCGAGAGACCGAAGTCTGAGATCTTCAGGTCTCCATTCTCG
TCCAGCAGCAAGTTCTCTGCGTCGTGCAAACGTCGGAATAATCAGCCGTAAGCCCGCACAGAACAGTCAAAGCCTTGCAATACGCACCCGGCTTCAGGTC
GCGATGGCAGACGCCGTTCTCGTGGCAGTACTGCACGCCGTCCACGAGCTGGCGGAAGTAGAAGCGCGCCGTATCCTCGCTGAACCTGCTCGTTTTCAAC
AACAAAAAGATCACCAAATGAGTCAGCCAAGTGAATCCTGCACCATCTCGTGCACCGACCGCCAAAACCCATGCTTGAACCACGTGCCTTCCTTCGCTCA
CGATCTTGTCGAACAGCTCGCCGCCCGTGATGAGCTCCAGCACGATGAAAATCTTGGTGCGACTCGCCAGCACCTCCTTGAGCACCACCACGTGCCGGTG
GCGCACCATCTTCATGATGGAGATCTCCTTCTTGATCTGGGCGCCCATGTTCTGCTTCTGGATCTTCTCCTTGTCCAGCACCTTGATGGCCACGCGCTCG
TCCGTCTCCGTGTTCACCGCATACTTGACTCTGCGCGCCGCAACAGGTTCGTCAGCGCCACGGTCTCTATATATTGATACTCAATTCCAGAGGGTCTCGA
CTCACTTTCCGAAGGTTCCTTCACCCAGCGTCTTGCCGATCTCGTACTTCCCTGGGGACCGCAGCAGCAGCAGCAGTAAGCATCAGACCCCAAGCCACGC
GGACAGATAAGAGAGATGCGTCCTCACGCAGCAGCGACAGCCCACGTACCGACTTTCTTGACCATTGTGGACCGCAGTCAACGCGATATCCGCGGTCTTC
TCCCCTTTGGCGTTTGCGGAGCTTTTCGCCGGGATTTTCGTTTCGTGGTGTGTGCCACACAGGTTTACGCGCCCATATCCACGCTAAGTACGAATCGTCC
ATCACTCTGCATTTCCGCACTCGAGTACGCAAGCGCATCATCTTGATGGAGGACGCACCGCCCACGCTCGAAGAGGCCGCCCCTGCGCTGCCGCTGATCC
CCGTGACGATCCTGTCGGGCTTCCTGGGCGCGGGCAAGACGACGCTGCTCAAGTTCATCCTGCAGGCGCAGCACGGCAAGCGCATCGCCGTGATCGAGAA
CGAGTTCGGCGACGAGATCGGCGTCGAGAGCCTCGTGGCCAAGGACGGCGCGGGCGACGACGCGCAGGTCATGGACGGCTTCTACGAGCTGAGCAACGGC
TGCGTGTGCTGCTCCGTGCGCAGCGACCTGGTGAACACGCTGGAGAAGCTGCTGGAGCGCCGCGACCGCTTCGACTACATCCTCGTGGAGACCACGGGCA
TGGCGGACCCGGGCAAG