Description :
From Genome Similarity Track
Location :
Scaffold_1296:231- 8879
Transcript NameFunction/comments
Phyag_g10196hypothetical protein
Phyag_g10197hypothetical protein PHYSODRAFT_476831

Sequence
8648 bases(100 bases per row)
cggaggtggcgctggtgccgcGGCTGGCGGACGTGGGGTGCCGTCCGCGACGCCGCAGCGCGCCAAGCCGACCATGCAAGCCATCGcggagatcgagaag
aaccGCGAGGACCGACGCCGCGCCATGGCAGCGGCCaagcgcgagcgcgagcgagagAGCCAAatgaacgagaagatggGCCACCCGGGCGACGTGGACT
TCCAGCGTATGATCAAGGCGTTCCGGGAGCAGAACAGGGACAAGAGCAGGCTGCACGTTGAGGCGGGGGAGACCAAGATCACCATCTGCGTGCGCAAGCG
GCCCGTGAACTCCAAAGAGGTCAAGAAGCACGACTACGACGCCGTGACGTGTCTCAACCCCATGGCCATCGTGCACGACTGCAAGCTCAAGGTGGACGGC
ATCACCAAATACCTCGACAgcaacgccttcaacttTGACCATGTGAGGAGCGCTGTCGTCAACTATTGTCAACGAGTGCAGATGAATTATTACTATTGat
atttgttgttgttgttgtagactTTTGATGAGAACGCGACCAACGAGAGTGTGTACCTGCACACGGCTCAGCCGTTGGTGAAGTTTGTGTTCCGGGATGG
AGGCCACGCTACGGTTTTCGCTTATGGACAAACGGGCAGTGGCAAGACCCACACGATGCAGGGCATTCAGAGTCAGATTGCGGCGGATGTTTTTGCCCAA
GTTGACGAGCTTGCGAGACGCGGGTATCCGTTGGATGTCTGTGTGAGTTTCTTTGAGATTTATGGAGGACGCTGTCAGGATCTACTGCATCGACAGGTGC
TGACTATTCGGGAggatggcgctggagaagtgcagattgtggacttggaggagGTGCGACCGCAGGATACTgaggaactgctgcaagtgATCCACAAGGG
TAATAGTCTTCGAACAACCCATGCTACGGAGGTAAACGACGTATCGTCGCGCTCGCACTGCATCTGTCAGATCAACCTTCGCGATAGAGGATCGGGACAA
CTGCATGGCAAGTTGTCATTGATCGATCTTGCTGGTAGTGAGCGTGGAGAGGACACGAAGAATCACAATCGACAGAGACGGATGGAATCGGCAGAAATCA
ATCGAAGCTTGCTGGCCTTGAAGGAGTGCTTCCGGCAAGTGCAAACCATTCCAATTCAGTATAATCTTTTGCTGACGTGTTGATTCTGACGACTATTACA
GAGCGCTCGACAGCGGTGGTCGAGGCACTCACATCCCTTTCCGAGCGAGCAAGCTAACTCAAGTCCTTAAAGACTCGTTTGTCAATGCCAAAGCGAGGTG
CGTGGTGACTGCGATTAATGCTATTGATTTTTTTTGTCTAATTGCTTGCTCCATGGATAGAACGGTAATGATTGCTGCGGTGTCGCCTTGTGCTTCGTCC
TCGGACCATACGCTCAATACCCTCCGCTATGCTGATCGGGTCAAAGAGAAACGTGTTTCAGCGGATGCATTTGATGAGGGAAATGCAGAGTCCGACGCTG
TGGACGTCGAAGACGTCCAATTTGAAGGTGCGTGTGAGGTTGGGCTCTTTGTATGGATCTTGATCGGCCCTGACAGGTGACTGCTTTCTAGACCTTGATG
GCGATGCGTACCCTGGACAAGATGAGGGTGATGATGCCGAAGATTACGACGATAATGCCGAAGATTACGACGATAATGATGAATATCAATCTGGAGTGGA
CGAAGACGGGGATGAAGCGATGCCCGAAGGCAACGGGGCAAGATATAAGAGCGAAGTTGCTGACAGCAATCCGGATCTGAGCGACGATTTGAGTAATCTT
CGTGTAAATCGTCGCCATTCGAGTGCGTTGCTGCGTCCCCTGCATATGATTCTGAACTGGGCTAACTTGTAGTATTACTTGACGCACACAAGCAGATAAA
CGGACAGGTGATCCCGTCGTGGAAAGTAGCTTTCCGGAAGAAGCGTGGCACGGAGTGGTACGGTGTTTGTTTGATGCTCCAAAAGCAATAACTGGGATAC
TCGTGACAGGTTCACACGTTGTACGAAGAGCAAGAAAGCTTGCTCAACACGCACATGAGCGCAATTCAGGTCGGTCCTTCTATCCATACCCAACGGTATT
TCTTTCTGTCTGACCCCTGTCATTCATTGCCATACCGTAGGAAAATGCAGAACTTCTTACAGAGGAAGGTGCTATGCTAGCAGCAATTCAAAACGACGAG
TCGGCAAGCATCGAGCAGTATGTTTCGCGCTTGGAAGAGGTGGGGTTGGCATTGTTGTGTCGTATAGATGTCAATGGCAACTCTACTTATGCTCGTTTGT
CTGTATTAGATTCTTGCTCAGAAGGCCCAGACCATCAGCACTCTTAGACGGCAACTTGCTACGTTCCGCCAGCACTGCGAtggggaggaggagaaagtCA
GCGAGACGCCACCCAAGAATGTGGTTGTGCGCGGCGGTCGTTAGACAAACAGAGTTGCATGATCTTTTGCTACCACCATGCTGCAGTTAACACGCTGTAT
CAACGACACAATTGCAAATAGAGCTTTGCTTTGACGATCAATGCTTGTATCGGCTGCATTCCTAATGGAATGAGAGAGGATCGCAAACGATGGTCCCTCA
CGATTGTCACCGAGCGCTATATTCTGTCGCAAACGGGCGTTCAAAATGTCGAGATGTCTCGCGCAACTTGACTTTCCGTCGCATTTTTCGTCATTTTTCG
TCATTTTTCAAGAAACCCCACCGGAAGATGATGCAGCGCACACTGACAACCAAGCTCCTCCCACGCGCAATAACAGCCACCAAGGGACAGACCACTCGCG
TCCCAGTGGCAATTGAAGCGGTCCTATGTCGTTCCGCAGTGCAGACGGAGACCAACGCATCTCTGCGTTCCCTCCCAGTCCCTGCAGCCTCAAATGACAG
ATTCTCCGCTCTTGCGGTTGCAGCGGCGGTGGTTGGAACAGCAGGCTTCGCTGCGAATGAGGCGCAATcggaagcagctccagacaagaagcaggaaaAG
GTTATTCGCCTTTTCGTTGATCTTTTGATGCTATTGTACATGACGAAATGTTTGCttgtttttgttgctgcagcactttgagTACGCTAAGGCGGTGGAT
ACTATCCGCCAACACGTGTCAGAGTTCCGTACGACGCTCAAGAGCTCGGAAACGCGCATCCCCAAAGCATTTCCGATCAAGAAAATTGGCATTTCGAGGA
TCCATGCGCCTAATGGTGTGTCCACGATCCGAATTGAGTTTTCGTGTCCGTCTTTTGTGGATCAGGAGGCGATATTGGGCcggttcttgctgcagttgca
gaaaACATCGACAATGGGCTCTCGGCAGGCTGTGGAAGTGATGCCGGTACCATTGGATAAAAGTGCAAAGAAATCTGTCGTGGAGTCCTATGAACAACCT
GCTGTGACGTACTTGTACGCGAATGGCTCAGGATCGTTTCAGTTCTTGCGAGATACGTCGTCGATGCAAGCGACGTCGAAGTTTGTATTTTACAAAGATG
ATTTTCTGACGCAAAGCGAAATTGATGCGGTGGTTGACGCATACAAGGAGATTTACTCGTACGCCAATGTGAACGCGTTCTTCCGCCACGATCTGGAACA
ACGTCGTAAAAACGCGCTTGTTGGGCGTGGGCGGAACCTGACTACAGCTACCGCGCCAACATCTGATAGCAAGGTTTGCTCGATGACACGTGTTGCAATG
TGTTTCTACTGGGATTAATTTACACTGTGCGTCATGTTACAGGAAGAAGCGATCCAACAGCTTCAGGGACTCGGTATCGATGTTTTCGAACCAACTCAGA
ACGAGAACAGTTTGACTTGGGATAGTCTGGTGTGTATTGCTTGTTAGTCAATTTTACAAGTATGGGAAACTTATTTCGTGAATGATCCACATGTAGGCTG
GATACGAAAAAGTGAAACTGGAGATTGAAGACACGGTTGTGCTGGCGCTTCAGAACCCAGAGTTGTATGAACGTATTGCACAGAAAACCCGATGCCGCTA
CGAAAGCAATCGCCCCCGCGCTGTGTTGTTTGAAGGGCCCCCCGGTACCGGAAAAACTTTAAGTGCCCGAATCATTGCTCAGCAGGCTGGCATCCCAATG
ATTCATATTCCGATCGAGAGTGTGGTATCCAAGTGGTACGGCGACAGTGAGAAAAAGATGTCGGCGATCTTTGACGCATGCGAGAAGCTGGATGGCGCCA
TTATTTTTATTGACGAAGTGCGTTGTTAACTTTAGAAAAAGAGTGCTGAGTCTGTGCTCACATTGCGTGTTCTGTGGTAGATCGATGCACTCGCCGGGGA
CCGCTCTGGTGGTACAATGCACGAAGCTTCGCGGCGAATTTTGTCAGTTTTACTGCAGAAGGTCGAGGGGTTTGCCTCTGCCAAGAAGACCACCGTTGTG
TGCGCTACAAACAGGTACCATCACGAGTTCGTATTGAATATTGGTCAAATGTGGGAGTAACTTTTCTGGTGTTGGTGATTGCAGAAAACAGGATTTGGAT
GCAGCTTTGATCAGCCGTTTCGATCTCTCCATTCGCTACAACCTTCCGGACGAAAAGACTCGCCGTGCCGTATTTGCACGGTAAACAGTGAACCGAAGAA
AAAAGGCTGTGTGAAACACAGGTACTGATATGCTGGTTGGTGTATCTTCCTTTGTAGCTACGCTAAGCAGCTCTCTGAtgaggaactgctgcagttggcc
ACTGTTTCGCCGCAGCTTTCGTGCCGAGACATCAAAGAGGTGGGTTTGTACTTtatctctgctgcagctggtaTGATAATTTTATCACctgcttgttgct
gtagATTTGTGAATATGCTGAACGCAAATGGGCCTCAAAGGTCCTTAAGAAGGAAGAAACCGCGGAACTGCCCACCCTGCGAACCTACATGGAGGCGATT
AAGACGCACATGGGAGGACTTTCCAGTCATGGGCCTCATCCTGATGTGTACGAGGCTTAAGGGTCAACCAAATAAAAATGTCATCCTAGAATGCGATAAT
GCGCTTCATTCACTGATCGCCTATTGTTGACTTCGCGTTCATTCTCAGAACCTCTTGATACTGCTTGTCCAGCTCATTGCCCAATTTTTCCACGAGTGGC
TCGCTGTGGTCTACACGGTCAGCATCACAAGTAAGAATGCAGTTTGACTGGAGATACTGAACAGACAACCACTTACGCATTATAGCTTGAGCCACCTTCA
TGAACTTGAGGGCATCGTCAGAATCATTGCTGCGGTAGGATAGCACACCCTGGACTCGCATGTATCAGCAATAGGAACATTTGTACTCGAAGCGACGATC
AAATGTGCTTACGATATTCCACGCCTTGGAGACGAACCACTCCATCTCGAGCTCAGAAAACACCAAATCCAATTTGGAAATGAACTCGAGTAGTTGGTCG
AAATACTCGTGCGCTTTTGACTTCGATTCCGCCAACATTACGAGCCGACGGAGCAAATAGCATAGCGAGCTCGGGTCGATGGGATTCGCTCGGACGAGTA
GCTGGAGTCTGTCGAACGATAAACCTATTCGTTAGATAGTGTCGGATATGACGATATGCGGATATAACTCTACCCGTGGTTGAATATTTCTCTCGCTAGT
GCTTGGTAACTGTCTCGAACCTGGTCAGACGGGTGTTGTGAAGGTGGTGATTGTAATCGTGCCCAATGCGAGCCTTACCTTGGACGCCTCATCGAACTTT
GCAGCATACAGCACCAGCTCTACAAAACACATACCATTTTAGATAAAAGGAACGGGTAGCACTTTGTAGACTACCCCACCTCCGATTTCCTCGAGGTCAG
CGGCGTTGTGAAGTGTGGTCATGCAAAGATCAAGCATTGCTTTCGTATTGGCATCAAGGAGCCGCACTTTCGCCACAACCGTCGCCTTAGCCTGCCACCA
AGACGTTGAATTAGGTATTACCAGTGAGGTTTACTCGTTTCTCTCATATAAGAGCGAGAGCTCATACCAGGTAGGTCATGACGTCAGGAGCAGCATCGCT
AGGAATATTCTGAAATCTTTCGAtcacttcaagaagctgtacGAGCTGATTGCTGTCCAAAGTCTCGATGTTCTTCATGTCGGAGCTTACCGCAGCCAGT
AAGCATCGATGGCTTTCCCGCTGGAGTGGGGATTTTTCTCCGTATAACTCGTCACTGCGCTCGGCAATatctgctgccaccacaaaaTATCTCGAGTCCT
CGGTGGCTTTGGCGATGTCAAAGCTGCAAGCACCATCAAAAAATATTTATCAAGCGCTTGGCTCAGTGGGAAGACTGATCACGAGTGCTTACCTCATTCG
GTAGAACCACTCGAAGACTGACGAAGGCCCTGAACGAACCATTAGGTCGGGGGTTCCTGGTTTTGACTGCTGCAACAGTGCATTAGCATACCCCAGGAAC
TTCTCGCTGTAGGAGCTTGTAGAATCGCCGGTTGACTCGGTTTGTTGCTGGGTCAATCTGCTAAATGCAAGCTGGGCTGCGTTCTGTAAGACTATCCCTG
CTGAAATCTTAGTAGGGCAGTTGTCTGTTTCCGTGAGCGTACTGCACATTTCGTCCACGATGTGCATCACAATATCTTGTCTCGATGGGCCAAAACCGCT
TGCTAGCTTTCCGATGGCGAACAAGTCTCCAATCTCGAAATCATTTCTGCCCTTCAATTGTTCCACGATGTGTACTAACGCATCCGTTTTGGCATTTAGG
GCACCTTGGAACACTGCAAAAAGCGATTGTTTGGAAGGCTCAACAGCTAAAGCCTTCTCAGCCCAATCCAAAGCTTCAGAATCGCGTCCCAAGTCGAGGC
ATGACCGCGACATGATCCTGGAGTGTTGCTTGAGTCAAACTCACTTTTAGGATACGCGCTCTAAAGAACTTGCATACCTCATGAATGTCGCTTTCTCTTG
TgctgttgacgctgcagctaAACCAGCGTCTGCCCACTTCAAACAGTCCTGCAATGTGCAACAGAAATTATTATCTACATTTCAACCACTCCGTCGCAGC
AACGTTACCTCGTGCTGGTTAGCATTCAGTGCATGCTGAAGAGCATCAAAAATGGTTCGCTGGATCCGCTGAAGGTGCTCTCTATCGGCAACTTGACCAT
CCCTGTGCCATACATACGCTATGTATGAGGTAGGTGTATATTCACCAGTCAATATACTAGATCCGTACCGCTCCCTTTCCGCCAAATCGATTCCAATGCG
CTTAAGTTCAGCCATCGCTTCATACCGCTTGTCCTCATCGAAAGCAAGATTACATGCAATCTCCACATTGATGATGAAATCAGCGCCATCGTAGTTCTCT
GCTAGCTCTCGATAAATATCCATGCCtttgctcgagaaggagagTGCCCGGGCGTAGATGCGTGCGCCGAGGATGGCATTTTCAAGATTATCAAGCTGAA
ACAGCAGTATCAGCGAGCGATTCGCTTGGTCAAACTTTTGATTGCCCACGTAGAGCCTTACCATCAACAGCAAGACTTCAGGGTCCCAATGATGAGGTAT
CAGTTGGTAGCACTTTTCTGCTCGCTCGATATCATCAGTAGCGCAAAGTGACCGCAGCAAATTCAGCATTACGTGCTGCTTGAACGAAGAAAGCAGCTCG
GGAAAGCTTTCATCGTCATTGCTTTCAAGCGATTCACCCACACGTAAAGCTTCTTCGGCGAACGCAACTTGCAATTCGTGCTGAGCCACCTGTGCGTATC
CATCACTCACGTTTTTCATGACGCCAAGTAAACTACTTGCGTACGAAGTCTTGTACGGTGCCAGCATTTTTAATTCATGTAGTGACGACACAATCTCTTG
GTACTCATCCGACAAATTGTCAGACCGCTCTAACATCAGTCGAAGCACCCGCACCCGATCAACACAGAAGTCCCACAAATCATCCACAACGTCCTCCAAC
TCTACGCCTTGCTTCAATTTTGTGAGATGAGAGAGTCCAATGCGCGACCAAAGTCGCAGTGAAGACGTAAACGACTCCTTGGCCAATACCAAGTACTCTT
CACATTTCTCGCAGTCAATTGATGCGCTCTCCAACATCAGCATGCCCACGCGTCCAAATGAGCGCAGCACATCGACGCACTCGTCCATGAACTGCATACT
CTTCTTCCCATCGCTCTCCTGCACTCTACCATCCTTCGACGAGCAGACCAACGACAGCCCCATGACCTTCGCAGCCACAAACCTTGTGACTGCCAGCGAA
TGCCTCGGGAATATTGTGAATTGTTCCCTCTCTCGACTCTTAGCCTTTTCTATCTGTGCCAGAACTCTaagagcagctcgaggcGCGTTGTAAAGCTCCA
CTCCAGCATTCATCAGCTGCGTCcccgacagctccagcacacgTTGGGACGCAAGGTCTGTCACCAGACGTTGAAGTTTCTTCAGTACTTGACTTAGCGT
GGCGGTATCCGCAGGTGAAATGCGGCAAGTGTCATCTGCTGCATGGGATAGGACCTCCGTCGCTTGCTCCACGAGCGTCAGGATGGTCGaagcgccttct
tcctgcatCTCTCCTGGTCCACTTGCTCTCCACGTGGCGAATTCCGCACTGAGCTTGCGATTCTGCGCggacaacttcgacgaccatcactcttcacgtc
aacttcaactgtaTCTATGGCTTCATTCGATTGGTATAGTCACTAAGa