Description :
From Genome Similarity Track
Location :
Scaffold_955:231- 7257
Sequence
7026 bases(100 bases per row)
TTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGCGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGA
TGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCCCATCGTCAGCGGTGGTAGCAACAGCCGCAGCCGG
GGCGGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGACGAGGATCGAGCGAGAACA
TGGATCAGCAAGGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCCGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGAGGCCAGCCAGGAATT
GGTATCGGCAGCTGGGTAGATCCACCAGGAACAAGTGGTCGGATTTGCTGCGCAGTTTCCAAACACAGTACTGTGGATTGAGGGTGTCGGTGGCACGATA
GTACTACCACGCTCGCCGCAGATCGGACGAATCCCCGCTGGAATATCTGCATTGACCAAATGTGGCCGGGCTACGGGCCAAGTTGAAGGCCAAGGATGGG
GGATCTAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGATGTGGATCTGGCGGACAGGCTGATCCTGTTACGCCTTCCAGACGCAG
ATGAGCTTGAAGAAGTACTGCAGGTTGTGGATCGCGCGAAACACCTCCAGAAGAAGGCGGCAGTCAGAATCGGAAAGTATCGCCAAAAAGCTCCGACACC
TACGGCCCCAGTTCGACGCGTCCACCAAGGCGCGGCGCCCGACTCAGGAACTGAATCAGATTCCGATGGTTTGACTCCGACCCATAGGATTACCGCCGAG
TCTGTCTCACTGCGTCCAACGATCGTACGGCGAAGACTGAAGACAACTCTCGCACTGGGGATGCCGTACCCGGGGACCGTGGGATGTACAGACCCGAGAT
CTCATGGACGGGACAGGATAAATCAGGTGCTCGCAGTGTGGATCCCGGAAGCACACAAAAGATGGATGCTGGAAACATCTGGTTTGTGAGAAGTGTGGCA
AGAAGGATCATCCCGGAGATCATTGCTTCTACGTGTGCCGCGGTTGTGGCGAGGTTCACGACATCGGCAAGTTCCCGATGGAGGAGTTCTACAACAAGAT
CCGCCAATAGTTTGATCCAGCCAAGCACAGAGGGATGATGCTAGAAGTGGCAGAGAAGCTGTTAAACTAGGTCGCTCGCCGGGTTTGAATCCGGTACGAG
CCGAGCGTTCTAGATATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATTCAGGTAGCAGGTCTCTATATCCAGTCGATAATACACGTGATCTACA
TGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAATTCGCCAGATCCGAAGTTTCTTCAACCCTGGATCTACAAAGGGGAAAAGCGCGC
GGCTACTGGGAGAAACGACAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCCCCGGTTTGTCCGGTCACTGGACCCGTGG
ATCTGAAGATGTTGGATCCATGGATCTGCTGACAGGGGAGTCCCGTGGATACTAGAAGTACCATGTCCCAGGAAAATGGTTCAGACAAGCCAAGGTAGGG
GTCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATATTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGG
ATGGGAGTCGGATCCAGGATTGTGTTGGGATTGGTGAAGGCGTGTACCGACGAATGGGAGAACGCGGATCCAGATCATGATGGCAGGCGGTTTGGTATAC
TGGTTCGACATTTGGGTTGGAGATCTCACTGGTCAAGATGCCATCCTCGGGATGTATTTCATGGTACCAGCCGGCGTAAGGTTGGATCTGGCGGATGGGA
CACTGTGTTTCCCGGACGAAATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCGTAAGGGCGGATAAGACGACCTGGAT
CGAGCTCGGAGAAACCTGGGAGCTGCCAGGTCGGTTGAAGTGGGTGGAACATGAGAAATGTGGGTCACCCGGGGTGAGAAGTGGGTGCCTACAGTATTCC
AAGGACCAGGTCGATCACAATACCTCCAGGTCACAAATGGCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATTGGGCGATGGTTGGCGAAGGA
TGGTGGGTATCCCTAGGCGACCTGGATATGTGTCAGTTGGATCCCGTCGCTACAGAGAATGGCAGAATCTGGCGTATGAGGCGACTACCGAGATCGAATC
CTTTGCGGAAGTGGAGCTCCCGGCGGAACCAACTGGCCCCTTGGTGGCCTTCATACCAAACTTCGCGAAAGTTCCTACAGAGGGATCGTCGGATTGGGAT
TCAAGTGGTAGAGATTGGACCCAAGCCCGCTGGTGATACCCAGAGCCGGTCCCTCGATAGCCCAGGTTCGGTGGATGTGGGATCGCAGATAATTGAAGCC
GGCTCGCTGGATCCTGCTGACCCACAGTTGGATTCGAGCTTTTCATAGGACAGCGTGCCCGGATCCTTGTCGAGAGTGGCAGCACTGGCTAAACAGGAAC
CGTCGTGTGTAAACTCACCAGAGGATCAAGTCGATTCAAAAGATAGTTTCCCCGGTACCAGGATACCCGATCCCATACAGACAGAAGAAATGACGGGAGA
AGGGGTGTCGCGGTGCTTGGGTCCAGTGGTGGATCGGACAAAGACTGAAGAAGAACAAGTCTGCTACCATGAAGGCGGGGATCTACACGCCGAGGGCTTG
GAGAAGGTATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAACGAACCCGCGGAAGT
GGATCGACTACGTCAGAAGATTTGGGAAAGCCGAAATCTGTTAATTGGCAAAGCGAATGCATTACCACCAGCTGCACGCGGAGTCAAAGGTGATATTGAT
GTCGGTGACGCGAAGCCGATCGCTCAAAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAGCTATTGAATCTGATTAAGGGTCTGCTACAAGCCAAAT
TAACAGTTTCTCAACGTCTTCGTGGGCGTCTCCTGTGGTGATCATCGTTAAGAAGAACGGAGTGGATAATGCTTGTGTATTGATTCCCGGATGGTTAACA
GCCTGACCCGACTGATGGTGTATCCGATGCCTTTAATCAATGAGCTATTGGAAGACTTGGATAAAGTACTCTGGTACTGTTATCTAGATATGGCAAGTGG
TTTTTGGGTGGTGACTATGACCGATCGAGCTCGCGCAATATCCGCATTCATCACACCATTTGGACTGTTCGAATGGAGCCGGATACCGTTTGGATTGAAG
AATGCACCCCAGATCTATCAACGCCTAATCGATAATGCCCTCTACGGATTTACCCGAATACCAGAACCCGTAAGAGGTGAATCCGGGGAAGGTCATACGG
AAGTGGATCCATTCGAAGCAGGAGAGCCAGGTGGATTGGGAACTCCATCCGTGTTAGGACGCAGATCCTATATCGACGACATTATAATCCCGGCGGAATC
TTGGAATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGTGGTGAAGAGCTATTGGGGGATGCGCAAG
GTGGATTACTTAGGTCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAAGACCTGTCTTCGTTGGAAGACTTGTCCTCCCACAGTCGCTACGGGC
GATGGAATCCTTCTTGGGTAGTTTGAACGACTACAGTCGGTTCATCGAGGATTACGCACTTTTTTGCTGCAGTACTCTATGAATTGAGGTACGTGCTTTT
TTTGCTGCGATGGCCACTTCGGCTGTCCGGATCAAGATCCAACAAGCTCTGGCCCTAGAGATCCCAGATCCACGAGGGGATCCACGTAGTACGACGCCGG
AAGACGCCTAAAACAGGAGCTGGATCCATCCCGGGACCAGCGGGGAGAGGATCCAATCTGGACAGAGCTGACGGAGGAAAGATCGGAAAAGGTGGAGCCT
CGGTGGATCCGAGTTCAGCACGCGTTTGTGGAGCTAAGGATAGGATCGCGACGACGCCCATCCTCCGCCATTTCGATCCGGAACGTCAGCCTACGGTGAT
AGTCTATGCTAGTGATTGGACGGTCTCAGCAGCTTTGGTACAAGAACATGAGGGGATCTGCCATCCGATCACCTTCGTCAGCCGAGCGATAAAGCCGAAT
GAGTTGAATTATGGAGCGGTGGAGAAGGAGATATTTGCACTCCTGCGGGTGTTGGATCTCAATTATATCCTGCTGGTGGGAAGATGTATCCGGATCTTGA
CTCGCCACTCCACGCCCGCCTGGTTGTTCAAGTCCGCCGGTCTACAAGGACGGTTGGGACAATGGGTAGCTTTACTTTCACCATGTACACTGGAGATCGT
AAAATGTTCCAAAGGCGAAAACGAGATCCTGGGAGTTTTGGCCGCGAGCATAACCCCCAGAGCCAAGATGGACGAAGCACTGACTAGGATCGCTCCTAAG
AAAGAACTCAAACGCCGGATCCAGATCCCTATCCCGACGGTACAAGCGGATGAAGATCTGTACATCCTGAATTTTGATGGATCTGCTCGCGTGCGGCGCG
GAGGAGGAGCATACAGCGCAATTATGTGGAAATTGCCCGGATGGGAAGTGGTAAGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAAGCGGA
GTATAAAGGACTCCTGCTAGGGTTGGATCTACTAAAGGAAGAGGATCCAGAAAGGCTGGTGATGTGTGGAGATTCGAATTTGGTGATCAGACAAGTGCGA
GGTCAAATTGATTGCGAGGCCCCGGCCCTGACGCGGTTAGGGCAGAAGGTAATGGTTCACTTACGTGGTTGGATGAATCACGAGCTGGTACATGTCAAGC
CAGATTGGAATGCCAGTCCAGACAGCTTAGCAAGTGCCGCTTTACGAAATCAATGTGGTGTTGAGGTGGAGAGAGGGGCCGAGCGTCAGGATCTCATCAG
ACTAAACCGACTAGACAAAGTGGTGGTGGTTGGATCCGTGAAGAGAACGGTCCAGGTAACGGCTGTCACTAGATCCATAGGAAGGATTGGATCCAGTCCC
CAGATTCTAGATGAAGCATTTGTGAAGGGAGTCCGTATTGAGCGGATTCTCAAAGCACAGAACGAAGAAGTGTGAATTCTGGGGCTAAAGAAGTATCTGA
TGGGGGATGTGCGAGACCTGAGTCGGGAGGACGCCAAATCCTACAGTATTATCACTATGGATTATGCAGTGGATCTGAATGATTTGCTCTTCTATTGTCC
CCCTACGAAACGAGTCAGCGGGGACCGAGACGGACTGATGAGATTAGTGATGCCGGAAACTTGCAACAGGATGTCTTACATCACTATCACGCTAGCTTTG
AAGGTAGCCATCAGGGAATCGGTCGGACCTACCAACGGATCCGAGAATGTTTCCACTGGAGGGGGCTATTCAAACGTGTACAATGATACGTCGGTGAATG
CGTGGATTGCAAGACAGACGAGGGCAGACCCACAATCGAAGGGGAATTTCCACGGAACGTCCAGGCAACTTATCCGCTCCAAATCATAGCCATGGATCAC
ATCCCCTCGCTACTGAAGCCATTCAAAGGAAACACAGAATTGTTGATCTGGGTGGATCTATTTACCGGATACGTGATAGCCAAAGCCAGCGCGTCCAGAA
CTGCACAGACCATCGCCGAATTGTACGAGGAGTGTGTGTTTTCGGAGATTTGGGGCTAGTGAGATGATTCGTCATGATCGGGGGAGCCAGGCTTTATGTC
TGATTTTTTTCGAGCCTTTAACCGGATCCTGGGCCAGAGACAGCGGGCAACTATGGCATATCGTCCCCAAGCTAATGGATCGGCCAAACGCATGGTACAG
ACGATCCCGAGGGCTTGTATGTTCAGGATTGGAATCCGAGGGATTGGGATGAGTACGCAGAACGACTCACCTTTGCGATGAACACTGGTCAAGACAGGAT
CCGGGGTGACACACTATTTTACTTGGTACGTGGGTGGGATCCTAAATCCACCCTAGAAACGGCTACTCAGGTATGGAGCACCATGAAGAGAAACCGAGAT
CCAAGACGATGGCGATACCTAGTCCAGCAATACTACCGGCAAACAGATCCCAAGTGAACAAACGGTTACGAAGTGCGATTCAGGATCGAGCGGATCGACA
CAGCGAAGACGCCCGTCCACATCAAATTCAAGTTGGAGCGCAGGTGTGTTTGGATCGAGTGAAGGAAGGATACGCCCGTAAACTGGCCCATCTCTGCCAT
GGACCGTTCCGAGTAAGGGAGAAGATAGGGTAACACGCTGTGAAGCTGAAAACGGCAGGTGCCGAATATCGCCTGTTCCCCGTGGTACACGTATCCAAGC
TGTAGCTGGTCAAGGAATATCCGGACCGGCCGCAAATCCGTCTCTCGGTGGATGAGTCCAACCAGGTGAATTTCGACGTAGTCCTCCTACCGGAAGATAG
TTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCTCCGACATGAGGTCAGGGAAGCGAACCAGATATGGGCGAATTTACCGCAAATTT
CAGGTGTATTGACGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGAGATCGTACGAATC
GGAACCGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGAGGATCCATGGGTGCGAGTCGGTCATATCGATGGGAGGACAAAAAAGCCACACAG
GAAGGGTGTGGGCCAGGAGGAGGAGG