Description :
From Genome Similarity Track
Location :
Scaffold_1973:231- 2347
Sequence
2116 bases(100 bases per row)
ACCGGAGGTCCCGTTGGCGCCTCCTGGTTCGTCGGCCGGTCATCTGTTGTGGCTTAAAAGGCTAGATTCTGCCATTCCATTTATCGACGAGATCCGATCG
ACACATATCCTGGAATCCGGGGTATCCGATCTCCAGCCAGCCACATCCTGATCCGTTCATTCCGGTGCAAGACGAGGTCTTTGTCGCTGATGTCGGTAAC
CTGGAGATATCTGATCCTGCCGGGTCCTCGGACCACGATTGGCACCCAACGATCTCCACGGGTGACCCATAGCTTTTCTCGATCCGTCACCTTCATTCGC
AGCGGAAGCTCGATCGAATCCCCGATCGCGATGTGCATTCCCTGATCCACACACACGTGTCGGACAATGTCGTTGTACAGTTGACGCCGTCCGCTAAGCT
GGATCTTGACTTCGTCGGGGAGACAGATAGAGCCGTCCGCAAGATCGAGGCGGATCCCCGCTGGAACCATAAAGTTCATACCCAGGATCGCTTCTTGTCC
TGATAGATCGCCGACCCAGGTATCGAAGAAATACACCAGCGATCCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCGCCA
ATCCCCACACATTCCTGGCTCTGACTCGTGTCGACACAGCACCCCACCTTACGAACAAAGGCGGTGTCCACGATGGACACCTCGGCGCCGGTGTCAAAGA
GTAAGATCGACTTTTCATTGTTGATCTTGCCAGTGATCTTGGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGACTCCCCAGG
GAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTCGCTGACGCGACGCCGACTTCGATCGCGATCATGCTCCGGGATCTCGGTCGTCACTTCTCCA
TCAGCTGGCGTGAACCATTCTTCCGGTCTGCGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGGCTGA
AGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACTCGATCTAC
CGTGTTCTTGTTCACGAATGCATAGAAGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCGA
TCGCGGGCAACATGCCAGCGTGCTTCACCGGGTTGAACCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGTAGTTCACC
ACATCCACGGCACACAAACAGGCAGCGATCCGCCGGATGACCTTTCTTGCCACACTTCTCGCACGTCAAACGTCTCCAACAATCGAGATCGGTGTGTTTC
CGCGATCCACAATGTGAGCAGCGGTTTGATCGCTCCGATCCGTCAGGTGAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGCGCCT
GGTTGCTTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTGCGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGACGTAGATCACCCTCCGAGTCCGA
TCCGTCTGATCCCGTGTCCGATTCAGACTCCTGGCTCGCGATCTGCACTGCACGCACTGCCCGCTTGGTTGCAGCAGCTGGTGCTGAGGTCGGAACGTTC
TGACGGTACTTCGATCCAAAGGCAGATCGCTTCTGTCTGCTCTTCGCGCGCTCTTGAGCGCGCAGGACTTCCTCCAGATCTTCTGCGTCCGCAAGCCGGA
GTAGAGTGAGCCGATCGGCCAGTTCCGGATCGCCCAGCGTCTCGATAAAGTGTTCGACATGTTCTCGACGGGCCTTGGAATCCCCGTCCTTGATCTTCAA
GCTTACACGCAGAGCCGCCACATTCAGTCGATAGAGGTACTCCAACGGCGATTCATCTGATCTCTTGCGAGAATGGTAATACTGCCAAGCGACCGATACT
CCCAGGCCACAATACTGGATCTGGAAACTCCGGAGTAGATCGCTCCACTTGTTCCGCGTCGATCGGCCCAGCTGGTGGTACCAGTTCTTCGCCGGGCCCG
TCAGTAGATCAGCAAA