Description :
From Genome Similarity Track
Location :
Scaffold_66:230998- 232540
Transcript NameFunction/comments
Hyaar_Emoy2807617hypothetical protein

Sequence
1542 bases(100 bases per row)
TGATAACATAACTTAGCTCGTTCGAAATCCATTAAAACGCACATTTTGTCTTATTTCAAATTGAAGCGTGCAAGCCTGACGTTCGTACGATTATTAATTT
CATCGGCACATATTTACGTGTAAAGCTTATAAAAGCTATCCCCTCGCTGCGTTAGTTTTGACAGAACTTCAAGCTGGTGTGTGCTTAACTAGATCAGCGC
TCTACCAGTAAGGTGTAAGCCATGAAATTTTCTTTGCGTGATGGTGCGTTGAGTTTGATGGACGCTATATCTGAAAGAATTGTGACTTCCCACTGCTAAG
ACTTATTCTTGGATCTACGCTCCTCGTTCAATTCTACTGCTCAAAGAATACGTCGAAGATCTCAGCCAGAGCACTAGATCTTACCATGCGGTCCAAGATT
AGGGGCAAGAATGTAGCACCGCATGACGTAGGTGCACGGTTTCTGATCGTTCCAACTGAGCACATTGCAGACGGTCATGTTAATAATGGCGTGCTCGTAA
ACGGGCGCCCACTAATTGTACCGAATACTGGCTTCATTTTCGCGGTGCATCTCGCCAGCGTTTGCAGCAGTAAACATGTTCCCAACTCATCCAGCTTTAC
TTCAGAGTCATCCAATCTACCAGAGATTTCGCTAAATTGCAACGGTGTCGTGTCGGAGACGGAAGGAGCTGCGTACAAGTTCGTCCAAGAATAGTTAGGC
GAGACATTTTATCATTTTGGTTAAGACCACGAGTAGGGCCCACCAGCTGGATGAATTGGGGAACCATGGGCCTTCGGCGAGCGGCAGTTCACTGCGGAAG
GGGTAGTAACCATACGATCAGACTCGCGCGGACACTGTCAGCACATTCAGTGATGTGCTGAAGTCTGATACTAGCATTCACCGCTTTGCACCTGATCCAC
GGATAACGCGCGCGAGCTGTTCGAGGACGTGGAAAAACCGGCGGTTCCTGGCCAATGTCGCGAAGTCTCCCTCCTCCTATTTTGGCCTCCGAACGATCGA
AATGATCTGCTAACCTTTGGCATCCATTACTTTACTTTGCGTCTCACAGAATTTGCTCACAGGCACCAAGCAGGCTCAGTGAAGCTGCTGGTATGCCAAC
ACTAGCTTTAATCGTGTATTTTTCGACTCACACTTATCACGTTGACGCTACGAGCTGTCGCAATAGAATCGTCAACTTGACGCCATTACATTCTGCAAAC
GTTTACTGAAGTAACGCAAGTGGTGCAGGCCACAAGTGCCACTATCAAAGCACAGGATGGGGGCATTGCAACGTATTTGTCAGTATAATACTCGACCAAA
GTGTTTAACAATGACTCCGGTAAAGTCCCAGCGTCAGTGAAGCTACGTTGTCGCTCTCTTGCGCAGAATTCGCGCGATTCCCAGCCGCTCAACGACAGCA
CTCATCCCTCTATCCCTCTTATAACGATAAATCATCTTTGTACACCAACTCGCCCATAATACCTCCCTGCTATATAAACCTTGTAAACATTTCGTACCTG
TCATAACACATTCAATTCATCTTCATCAACATGGGAACTGAA