Description :
From Genome Similarity Track
Location :
scaffold_9:230983- 235588
Transcript NameFunction/comments
g4521.t1hypothetical protein

Sequence
4605 bases(100 bases per row)
CGACGCCGAGTACCCTGATGCGGCTGACGCGTACGAGACCGAAGACATGACCGATGGGCCAAGTCGCGACACCGCGTCGGCGTTAGTGGTGGCGGAGAAA
TCAGGGGCGAACATTTTCCCTGGTGTTGAAGAACACCTCGAGAAACTGGCGGGGTCCTTTCTCGTCCAAGCGCGATATCTTGTTGAGGGGCACGCGATGC
TGCAGTCCCAGCAAGAAGGGCAGAGTAATGCTCAGAGCGCCGCTCTAATGGCCGTTAAGGACTCGACCGAAATCTGCATCAAGGAGCTAACGGATCGGCA
GCTTGCAATAGCTGGTCAGTTCCAGGAAGAGTTCAATCGGCCATCTGTGAACAGTTTATGGCGATGCAGGCGCAAGCTGGAGAGCAGATCAAAACGTCTG
TGACGGAGAAGCTCTTCAATGCGCTGCGTGAAGTGCAGTGTGAGTCCCAGGAGCTAATAACCTCCCAAACGAATGGAGTCAGTCGACTGGGACTCAGCTG
GCCGCCAAAATTAATGACATCTTCCAGATACTTACATCTCGGATCCAGCAGCTGGTCGAGGAGCAAACGGCGGTACGGCAGCATGCGAGCACCGCTTCCG
ATAAAACTGTCGAGCCCGATTTTGAGCTTGTGGAGAAGTCCATGACAGGCATAAACGCCCGCGTGGAACAATCGCTAGAAAGGGGTTTACAAGTCGCGCG
CGATGAACTAAGGCAAGAAGTGTTTATAAGCGCGGTGGCCTCGACTGGAGAGTCAGCACTCGACGCGGTTAAGCATTTAGTGGCGACTGAGGCAATAAAA
TCAGAGCGACGTATCGAGGCACAAGTGCAGAGAGGACTGACGTCCTTCCAGACTGATATACAACTTCAAGTTCAACGCCAAGCGGACGCAACTTCCATTC
TGCGGGATCAGTTCCAGCAGCACTGCGATTGTGCTAAATTAAAGCAAGGGTCAGCAGGTGAGGGACTTCGCAGTGACGACGCAAAGGAACTTGTGCGAAA
GGAGGTGGACGAGCGCATGACTACTTTGCAGCGCCAATTCCATGACGTGGAACGCGAGCGACAAGCTGAATTGCAAGCCAATGAAACGAAATTGCGCCAA
TTGCAGGCCGTGGAGCACGCACGTGAAGCCGAATTGCAAGCGAAAGAGGCTGAGGTAAATCATGGTGTGACAGAGGTGGTTGGAGAGCGTCTGCGAGATC
CTGCAGCCGATATCTCGGCAGAGATCAAGCAATCACTGAAGAGAAGCGTGAAGACGATAATTGAACTCATTAGTGTTGCTGTCGATTGCAACGCGCAGAC
AGACGAGGAGATCAAGACAGAGATTGAAAATCATGGCAACATTAGTGAAGATGATGGAGATGAAAATTACGATGAATTGTCGGAAGAAGATCGCTACGCA
CAGCAGCGAATGCGGGACGCCCTCATTAGGGCTTAAGCTGCAAGCACACCACCGATACCTTCACTCCGCCCTCATTAGGGCTCAAGTCGCAAGCACACCA
CCGATACCTTCACTCGTTGTGCATGTGGAAGGACCACTGCTTCAAGATGGCGAGCGTTTTAGAAACAAATACGAACACCATGGATTTCCACCAGTAGTGC
AAGGTCGTGCTACGCCATCTCAGCGTGTTCGTGGCGGTTGCAGAGATGGTGGTCGCAATGGAAGAGACTGCTGATGTCCTGAAGACCGCTGGAGAACCTC
ACCGTGGAAATGATACCGAGTCTGTGGAGGTGGCGAGGTGGGATGGAGGTTGTCGTCAGACCGTCGTCTAAGAAAACGTCCCTGAACTCAAGCAGGAAGG
CTGTTATCGCGGTGCCTGCGGTGATAAACTCACCGTGAGAAATATACCATAGTTGCCGAGGTGGTTGTGTCATGCGGGACGAATACGACGATAAGACGAA
ATAAACGTAAACGAAAAAAAGCATATGATAAAAAAAGATGTTAAACACAGTGAACGTGAAACTACGAGTTCGTGAAACTATGAGTTCTCATTCTACTCCT
CGTTCAAGCTGAAACTCGTGCTCGACATGAAGTCAGCCAAAATGTCATCAGAGAAATAATCCTCCATGTCCCAATCCAGATCCAGAGGGTAAATGAAGCA
GGAGGGCGTGTTTCCCCCTTTTGATCGCCTCACACTGCAGTAGATCCACAAATTCGTCGTTGCGGTTCAGGAACGTGGCCATGTCGATGTTGTGTTGCGA
CAAATTGGTACGTTGTGACGTAACCATACTTCCGCTAACGCTGAAGTCCCGCTCAATCTGGCATGATGATGCTGGGATGGCAAAGAGCACTTTCACTGCA
CGCGGTAGGAAGATGTAGTATTTGCGGTGCTAAACTCGCCGCCAGAATGACAGAACCGATTCCGGTGCACCTGACTCCGACCGTTCCACCTCAATTGGGT
CGTATTTCTAGCGATCCAGCTCTTCGTCCACGCGTCGCTGCATTTGATTCACAGTGACAGCCGCTGATCTGCGCGGAGGATTGGCAAACATCGCCTCGAG
CTCACTATAAAACGGGATGGGACTTGGAGGAGGTGGCTCGACTGTATCACTTGGATCCGCTACAGCGTTCAGCAAGGTGTGTAGCCGGTCGCGAATATGC
TCGTGCACTTTGTCCCTCTTATCGCAGGCCTCACGTATTCCAAACCCTTGCTGTTTGCAGACTAGCAGGATGACGGCATTTAGGTTCAATCTCGGGCTTT
TGAAAATGGGATGCAGTCTCTGCTGCATCTCAAATACATACGAAGTTTTTGCCATTTTGGTGTCTTCGTAGTAGCGGCTGAAGAAGCGTTCATCAAACGC
ATCACGGAGTAGTAGTCGGGTAGACTTCGCAAGTGGTGTGAACTCGTTCGGTTCATTCCAACGAGGGTTCTTGTCGGTGCTGAGGTAGTGTCGAACAGGT
TTTTCGTTGTTTAGGTCAGTCAATCGAAGCTTGTATATCATCACCAGATGTCCACTTGATTAGGCGCCTCAGCTTGGCTCGCCCGTTTAAGCTCTGCTAC
AGGACCCAGGACAGACAGCACATGGCTTAAGTCCTTTTCTCGACCGGCAAGCGGAAACACAGGTGGGCGAGTCTTATCTCGCACTGCCTTCCTCGCGCGC
TCTGCAAACCATTCTTCAAGCGCCGGCCACTTTTCCAGAACTCGCCGGATAGCGTGGTGATACTTAGAAATCGGGCGGAGGAATAGTTCAGCAAGCGCGT
CGTGGAGGTCTCGGTCCTCAAGTTGCATAGTGCTTCGAAGAGATCACCCGTTACTTCGACCGTGCGTACTTGCTAGATGGTTGTAGTTAGCTGCGTAATT
AATTCAGTCATTTCTGGATTCTCCTGTTATTTCTTGTCGTTCATACCATACGCAGAGCGAGTTGCGACATGAGCCATATGTGCTATGCACCACTCCCATC
GTAGTTATAGCTCATCCATCAGTAGACACCTCACATCGGAGCCCTTGTCGCTCGTGGCACCGTAGAAATTCGAAATAGTCAACCGAAAGTCCTCCACAGT
GCGCTTCATCCATAACAGAAACGGCCTTCTCATACCTTTGTCACGATCACCGTATGAGGGACTAAACTTGCGCGTGCTCAGCAGCAAGAACCTGAACTGC
CAATTCCTGTCAAATAGGTAGACACGTAGGCCAAGGTACTTCTTCGACGTCGTTTTGCAAGTCCAAAGTCTGCCGTCATCGTGAAGTTCGGGTACACCTC
TTTGTTGCTCTAAAAAAAACTCGGTGATGTCCTACCTCGTGGAGGAATACAACTCGATGATAGTTTCACCGATTCGCTCCGCAGTTATGATGACTTTCAT
CTCCTCCCTCTTGGCGTGGGCCTCCAGCAACTTGGACTCCTCGTACCCACATATACACAGCGGCAAGTTGTGGTTGATGTTGCGAAGCGTTTCCAGGAGA
ACGTTCAAACGTGTTGGATTCGCGCGTACATCGTCGACGATCGCAGGTGCTCGATCTCTACTTCACGTTTTCGTTTTGTCTTGCCTTCCTTCTTGGTTTT
CGGCGATTCGAGGTGGTGGACTAGACGTAGATGCTTAACAGCGGCGGAGGTCCTTCCCTTTGACAGTAGGAACAGGTTGGTGGCGTTGTCCGCGTTTCGA
CAGAATTAATCTGCCATGCAGATGAACCCGACCTTCGTCTTGTTGCCCTCGTCGTACTCGACACGCACACCCCAGTCAAAAATGAAGGACGTCTTACCAG
GTAGCGCAGGTCTCCGTCTGAAGGGGCCGATCTCAGTCCAGTTCTTGATTGCTTGTCTGACTGCTGCTGGTGCGGACGACATCGTGGACGTTGCGTCTGA
GCCTCGGCTCTGGACTGGGAGCTCGGTGGCAGCACCTACACTTGATGTTGGTTCCGCCTTGGACTCGGACTCGCGGTTCTGCATGCCATGCTCGATGCTG
CGCGAGCTTGGACTGGGGCGATCTGAGTATTTTTTGCGACTGCGGAAGATCACCGTAGTTTACGACGCTGATATTAGCCAATAGAAATGGCTGCTGACGA
GCACGGCCTCTGGCGACCTCGTCAGAACGAGCAAATTCTCTCGAGCACCAAAGATTGCTCGTGCCTCTCGTACTTAGGCAGAGCGAGGAATAAAATCTTA
AAAAA