Description :
From Genome Similarity Track
Location :
contig_9:230934- 235538
Transcript NameFunction/comments
g2618.t1hypothetical protein
g2619.t1hypothetical protein
g2620.t1hypothetical protein

Sequence
4604 bases(100 bases per row)
TTCCTCTGCTTCACTGCCTCGACTAACGAAGCCGTGAACTGGAAATCTTGGTAGTGCTTGTCCGAGCGGAGAAAGCTTCGAACAGACCAGAATGGCTCAG
TTTCGTGCTCCAGGTCGATTGTACTGTTCCAGATGCGGTTCAATAGCTTCAGAGAGCCGAACGTGCAGGCTTTATGCAGTGGAAGCTCCACCGATGTGTC
CAGGAAGGAAGAAACCTTTTCAGTGATGTGGAACAACGATGACAACTCGCGCTTGGAACCGGTGAGAATCGACGCAGCTACCAGCGGAGTAGGAGGTGGA
GGTGGGGGAGATGCCATCGTTGCAATGGCAAATGCTGAATGACCACAGACAACCTGCAAACTCCACACCACCTGTGTCTTGGGTACAAATGATACACCCC
AGTTGTGCGCAGGTCACCACGGTTTTGCCAGAGCAAATGACGAGCACGACCCGTGAGGTTTTTCCTCGAGCAATAAAACCTTACGAGCAGTGTTCGCGAG
GTTTTTCAATTCGACCTCACTTATCACTTTTTTGGGGGGAGCACGAGAGTGTCAGGTGCATTTGCTCGTTCTCCGGCGCTTCAATTGGGTGTAAAAGACC
ATTTTTTAATTGGCCGTTATTCAGCGACGATCATCTGCAGGCGTAAGTAAAATATAATCCCGCTTTCCAGCAAGTCCGTCCACCCCAGCAAGTCCCCGCT
CCCGACGTCATGGTACTGACCCGGGCCCAGGCGAAAGCAGAAGCGGAGGCTCAAGCTGCGCGAGGCAACGAAGACGATCACGATGAAGACACGTACGACC
CCCCAAGCGCCGACGCCGAGTACCCTGATGCGGCTGACGCGTACGAGACCGAAGACATGACCGATGGGCCAAGTCGCGACACCGCGTCGGCGTTAGTGGT
GGCGGAGAAATCAGGGCGAACATTTTCCCTGGTGTTGAAGAACACCTCGAGAAACTGGCGGGGTCCTTTCTCGTCCAAGCGCGATATCTTGTTGAGGGGC
ACGCGATGCTGCAGTCCCAGCAAGAAGGGCAGAGTAATGCTCAGAGCGCCGCTCTAATGGCCGTTCAGGACTCGACCGAAACCTGCATCAAGGAGCTAAC
GGATCGGCAGCTTGCAATAGCTGGTCAGTTCCAGGAAGAGTTCAATTGGCCATCTGTGAACAGTTGTGGCGATGCAGGCGCAAACTGGAGAGCAGATCCA
AACGCCTGTGACGGAGAAGCTCTTCAATGCGCTGCGTGATGCAGTGTGAGTCCCAGGAACTAATAACCTCCCAAACGAATGGAGTCAGTCGACTGGGACT
CAGCTGGCCGCCAAAATTAATGACATCTTCCAGATACTTACATCTCGGATCCAGCAGCTGGTCGAGGAGCAAACGGCGGTACGGCAGCATGCGAGCACCG
CTTCCGATAAAACTGTCGAGCCCGATTTTGAGCTTGTGGAGAAGTCCATGACAGGCATAAACGCCCGCGTGGAACAATCGCTAGAAAGGGGTTTACAAGT
CGCGCGCGATGAACTAAGGCAAGAAGTGTTTGTAAGCGCGGTGGCCTCGACTGGAGAGTCAGCACTCGACGCGGTTAAGCATTTAGTGGCGACTGAGGCA
ATAAAATCAGAGCGACGTATCGAGGCACAAGTGCAGAGAGGACTGACGTCCTTCCAGACTGATATACAACTTCAAGTTCAACGCCAAGCGGACGCAACTT
CCATTCTGCGGGATCAGTTCCAGCAGCACTGCGATTGTGCTAAATTAAAGCAAGGGTCAGCAGGTGAGGGACTTCGCAGTGACGACGCAAAGGAACTTGT
GCGAAAGGAGGTGGACGAGCGCATGACTACTTTGCAGCGCCAATTCCATGACGTGGAACGCGAGCGACAAGCTGAATTGCAAGCCAATGAAACGAAATTG
CGCCAATTGCAGGCCGTGGAGCACGCACGTGAAGCCGAATTGCAAGCGAAAGAGGCTGAGGTAAATCATGGTGTGACAGAGGTGGTTGGAGAGCGTCTGC
GAGATCCTGCAGCCGATATCTCGGCAGAGATCAAGCAATCACTGAAGAGAAGCGTGAAGACGATAATTGAACTCATTAGTGTTGCTGTCGATTGCAACGC
GCAGACAGACGAGGAGATCAAGACAGAGATTGAAAATCATGGCAACATTAGTGAAGATGATGGAGATGAAAATTACGATGAATTGTCGGAAGAAGATCGC
TACGCACAGCAGCGAATGCGGGACGCCCTCATTAGGGCTTAAGCTGCAAGCACACCACCGATACCTTCACTCCGCCCTCATTAGGGCTCAAGTCGCAAGC
ACACCACCGATACCTTCACTCGTTGTGCATGTGGAAGGACCACTGCTTCAAGATGGCGAGCGTTTTAGAAACAAATACGAACACCATGGATTTCCACCAG
TAGTGCAAGGTCGTGCTACGCCATCTCAGCGTGTTCGTGGCGGTTGCAGAGATGGTGGTCGCAATGGAAGAGACTGCTGATGTCCTGAAGACCGCTGGAG
AACCTCACCGTGGAAATGATACCGAGTCTGTGGAGGTGGCGAGGTGGGATGGAGGTTGTCGTCAGACCGTCGTCTAAGAAAACGTCCCTGAACTCAAGCA
GGAAGGCTGTTATCGCGGTGCCTGCGGTGATAAACTCACCGTGAGAAATATACCATAGTTGCCGAGGTGGTTGTGTCATGCGGGACGAATACGACGATAA
GACGAAATAAACGTAAATCATATGGTCACACAAAACACATATATTAAACACAGTGAACGTGAAACTGCGAGTTCGTGAAACTACGAGTTCTCATTCTACT
CCTCATTCAAGCTGAAACTCGTGCTCGACATGAAGCCAGCCAAGATATCATCAGAGAAATCATCCTCCATGTCCCAATCCAGATCCAGAGGGTAAATGAA
GCAGGAGGGCGTGTGCTCGCGGTGTTTCCCCCTTTTGATCGCCTCACACTGCAGTAGATCCACAAATTCGTCGTTGCGGTTCAGGAACGTGGCCATGTCG
ATGTTGTGTTGCGACAAATTGGTACGTTGTGACGTAACCATACTTCCGCTAACGCTGAAGTCCCGCTCAATCTGGCATGATGATGCTGGGATGGCAAAGA
GCACTTTCACTGCACGCGGTAGGAAGATGTATTTGCGGTGCTCAACTCGCCGCCAGAATGACAGAACCGATTCAGGTGCACCTGACTCCGACCGTTCCAC
CTCAATTGGGTCGTATTTCCAGCGATCCAGCTCTTCGTCCACGCGTCGCTGCATTTGATTCATAGTGGCGGCCGCTGATCTGCGCGGGGAGGGGCAAACA
TCGCCTCGAGCTCACTATAAAACGGGGTGGGACTTGGAGGAGGTGGCTCGACTGCATCACTTGGATCCGCTACATCGTTCAGCAAGGTGTGTAGCCGATC
GCGAATATGCTGATGCACTTTGTCCCTCTTATCGCAGGCCTCACGTATTCCAAACCCTTGCTGTTTGCAGACCAGCAGGATGACGGCATTTAGGTTCAAT
CTCGGGCTTTTGAAAATGGGATGCAGTCTCTGCTGCATCTCAAATACATACGAAGTTTTTGCCATTTGGTGTTCGTAGTAGCGGCTGAAGAAGCGTTCAT
CAAACGCATCACGGAGTAGTAGTCGGGTAGACTTCGCAAGTGGTGTGAGCTCGTTCGGTTCAATCCAACGAGGGTTCTTGTCGGTGCTGAGGTAATGTCG
AACAGGTTTTTCGTTGTTTAGGTCAGTCAATCGAAGCTTGTATAGCATCATCAGCACGTCCACTTGATTAGGTGCCTCAGCTTGACATGCCCGTTTAAGC
TCTGCTACAGGACCCAGGACAGACAGCACATGGCTTAAGTCCTTTTCTCGACCGGCAAGCGGAAACACAGGTGGGCGAGTCTTATCTCGCACTGCCTTCC
GCGCGCGCTCTGCAAACCATTCTTCAAGCGCCGGCCACTTTTCCAGAACTCGCCGGATAGCGTTGGTGATACTCAGAAATCGGGCGGAGGAATAGTTCAG
CAAGCGCGTCGTGGAGGTCTCGGTCCTCGAGTTGCATAGTGCTTCGAAGAGATCACCCGTTACTTCGACCGTGCGTACTTGGTAGATGGTTGTAGTTAGC
TGCGTAATTTATTCAGTCATCTCTGGGTTCTCCTGTTTTTTCTTGTCGTTCATACACACGCAGAGCGAGTTGCGGCATGAGCCACATGTGCCATGCACCA
CTCCCATCGTAGCTGTAGTTCATCCGTCAGTAGACACCTCACATCGGAGCCCTTGTCGCTCGTGGCACCGTAAAAATTCGAAGTAGTCAATCGAAAGTCC
TCCAAAGCGCGCTTCATCCATAACAGAAACGGCCTTCTGATACCTTTGTCACGATCACCGTAAACTTGCGCGTGCCCAGCAGCAAGGACCTGCCAATTCC
TGTCAATTAGGTAGACACGTAGGCCAAGGTACTTCTTCGACGTCGTTTTGCAAGCCCAAAAGACTGCCATCATCGTGAAGTTCGGGTACACCTCTTTGTT
GCTCTAAAAAAACTCGGTGATCTCCTTCCTCGTTTCGATGATAGTTTCACCGATTCGCTCCGCAGTTATGATGACCTTTCATCTCCTCCCTTCGTGGGCC
TCCA