Description :
From Genome Similarity Track
Location :
contig_9:230903- 235507
Transcript NameFunction/comments
g2774.t1hypothetical protein

Sequence
4604 bases(100 bases per row)
ACACCCCATTCGGGAAAATGTTCAAAGAGCCACTGCACCATCTCGAGATTCCTCTGCTTCACTGCCTCGACTAACGAAGCCGTGAACTGGAAATCTTGGT
AGTGCTTGTCCGAGCGGAGAAAGCTTCGAACAGACCAGAATGGCTCGATTTCGTGCTCCAGGTCGATTGTACTGTTCCAGATGCGGTTCAATAGCTTCAG
AGAGCCGAACGTGCAGGCTTTATGCAGTGGAAGCTCCACCGATGTGTCCAGGAAGGAAGAAACCTTTTCAGTGATGTGGAACAACGATGACAACTCGCGC
TTGGAACTGGTGAGAATCGACGCAGCTACCAGCGGAGTAGGAGGTGGAGGGGTGGGGAGATGCCATCGTTGCAATGGCAAATGCTGAATGACCACAGACA
ACCTGCAAACTCCACACCACCTGTGTCTTGGGTACAAATGATACACCCCAGTTGTGCGCAGGTCACCACGGTTTTGCCAGAGCAAATGACGAGCACGACC
CGTGAGGTTTTTCCTCGAGCAATAAAACCTTACGAACAGTGTTCGCGAGGTTTTTCAATTCGACCTCACTTATCACTTTTTTGGGGGGAGCACGAGAGTG
TCAGGTGCATTTGCTCGTTCTCCGGCGCTTCAATTGGGTGTAAAAGACCATTTTTTAATTGGCCGTTATTCAGCGACGATCATCTGCAGGCGTAAGTAAA
ATATAATCCCGCTTTCCAGCAAGTCCGTCCGCCCCAGCAAGTCCCCGCTCCCGACGTCATGGTACTGACCCGGGCCCAGGCGAAAGCAGAAGCGGAAGCT
CAAGCTGCGCGAGGCAACGAAGACGATCACGATGAAGACACGTACGACCCCCCAAGCGCCGACGCCGAGTACCCTGACGCGGCTGACGCGTACGAGACCG
AAGACATGACCGATGGGCCAAGTCGCGACACCGCGTCGGCGTTAGTGGTGGCGGAGAAATCAGGGCGAACATTTTCCCTGGTGTTAAAGAACACCTCGAG
AAACTGGCGGGGTCCTTTCTCGTCCAAGCGCGATATCTTGTTGAGGGGCACGCGATGCTGCAGTCCCAGCAAGAAGGGCAGAGTAATGCTCAGAGCGCCG
CTCTAATGGCCGTTAAGGACTCGACCGAAATCTGCATCAAGGAGCTAACGGATCGGCAGCTTGCAATAGCTGGTCAGTTCCAGGAAGAGTTCAATCGGCC
ATCTGTGAACAGTTATGGCGATGCAGGCGCAAGCTGGAGAGCAGATCAAAACGTCTGTGACGGAGAAGCTCTTCAATGCGCTGCGTGATGCAGTGTGAGT
CCCAGGAGCTAATAACCTCCCAAACGAATGGAGTCAGTCGACTGGGACTCAGCTGGCCGCCAAAATTGATGACATCTTCTAGATACTTACATCTCGGATC
CAGCAGCTCGTCGAGGAGCAAACGGCGGTACGGCAGCACGCGAGCACCGCTTCCGATAAAACTGTCGAGCCCGTTTTTGAGCTTGTGGAGAAGTCCATGA
CAGGCATAAACGCCCGCGTGGAACAATCGCTAGACAGGGGTTTACAAGTCGCGCGCGATGAACTAAGGCAAGAAGTGTTTGTAAGCGCGGTGGCCTCGAC
TGGAGAGCCAGCACTCGACGCGGTTAAGCATTTAGTGGCGACTGAGGCAATAAAATCAGAGCGACGTATCGAGGCACAAGTGCAGAGAGGACTGGCGTCC
TTCCAGACTGATATACAACTTCAAGTTCAACGCCAAGCGGACGCAACTTCCATTCTGCGGGATCAGTTCCAGCAGCACTGCGATTGTGCTAAATTAAAGC
AAGGGTCAGCAGGTGAGGGACTTCGCAGTGACGACGCAAAGGAACTTGTGCAAAAGGAGGTGGACGAGCGCATGACTACTTTGCAGCGCCAATTCCATGC
CGTGGATCTCCAGGCCGTGGAACGCGAGCGACAAGCTGAATTGCAAGCCAATGAAACGGAATTGCGTCAATTGCAGGCCGTGGAGCACGCACGTGTAGCC
GAATTGCAAGCGAAAGAGGCTGAAGTAAATCATGGCGTGACAGAGGTGGTTGGAGAGCGTCTTCGAGATCCTGCAGCCGATATCTCGGCAAAGATCAAGC
AATCACTGGAGAGAAGCGTGAAGACGATAATCGAACTCATTAGTGTTGCTGTTGATCGCTACGCGCAGACAAAGCAGGAGATCAAGACAGAGATTGAAAA
TCGTGGCAGCGTTAGTGAAGATGATGGAGATGAAAATTACGATGAATTGTCGGAAGAAGATCACTACGCACAGCAGCGAATGCGGGACGCCCTCATTAGG
GCTTAAGCTGCAAGCACATCACCGATGCCTTCACGCCGCCCTCATTAGGGCTCAAGTCGCAAGCACACCACCGATACCTTCACTTGTTGTGTATGTGGAA
GGACCACTGCTTCAAGATGGCGAGCGTTTTAAGAACAAATACAATCACCATGGATTTCCACCAGCAGTGCAAGGTCGTGCTACGTCATCTCACCGTGTTT
GTGGCGGTCGCAGAGGTGGTGGTCGCAGTGGGAGAGACTGCTGATGTTTTGAAGACCGCTGGAGAACCTCACCGTGGAAATGATACCGAGTCTGCGGAGG
TGGCGAGCTGGGATAGAGGTCGTCGTCAGACCGTCGTCTAAGAAAACGTCCCTGAACTCAAGCAGGAAGGCTGTTATCGCGGTGTCTGCGGTGATAAACT
CACCGTGGGAAATATACCATAGTTGCCGAGGTGGTTGTGTCATGCGAGACGAATACGAGGATAGGACGAAATAAACGTAAAGCATATGATCAAACAAAAA
ACATATATTAAACACAGTGAACGTGAAACTACGAGTTCGTGAAACTACGAGTTCTCATTATACTCCTCGTTCAAGCTGAAACTCGTGCTCGACATGAAGC
CAGCCAAGATATCATCAGAGAAATCATTCTCCATGTCCCAATCCAGATCCAGAGGGTAAACGAAGCAGGAGGGCGTGTGCTCGCGGTGTTTCCCCCTTTT
GATCGCCTCACACTGCAGTAGATCCACAAATTCGTCGTTGCGGTTCAGGAACGTGGCCATGTCGATGTTGTGTTGCGACAAATTGGTACGTTGTGACGTA
ACCATACTTCCGCTAACGCTGAAGTCCCGCTCAATCTGGCATGATGATGCTGGGATGGCAAAGAGCACTTTCACTGCACGCGGTAGGAAGATGTAGTGTT
TGCGGTGCTCAACTCGCCGCCAGAATGACAGAACCGATTCAGGTGCACCTGACTCCGACCGTTCCACCTCAATTGGGTCGTATTTCCAGCGATCCAGCTC
TTCGTCCACGCGTCGCTGCATTTGATTCACAGTGACGGCCGCTGATCTGCGCGGGGGAGGGGCAAACATCGCCTCGAGCTCACTATAAAACGGGGTGGGA
CTTGGAGGAGGTGGCTCGACTGCATCACTTGGATCCGCTACATCGTTCAGCAAGGTGTGTAGCCGATCGCGAATATGCTGATGCACTTTGTCCCTCTTAT
CGCAGGCCTCACGTATTCCAAACCCTTGCTGTTTGCAGACCAGCAGGATGACGGCATTTAGGTTCAATCTCGGGCTTTTGAAAATGGGATGCAGTCTCTG
CTGCATCTCAAATACATACGAAGTTTTTGCCATTTGGTGTTCGTAGTAGCGGCTGAAGAAGCGTTCATCAAACGCATCACGGAGTAGTAGTCGGGTAGAC
TTCGCAAGTGGTGTGAGCTCGTTCGGTTCAATCCAACGAGGGTTCTTGTCGGTGCTGAGGTAATGTCGAACAGGTTTTTCGTTGTTTAGGTCAGTCAATC
GAAGCTTGTATAGCATCATCAGACGTCCACTTGATTAGGTGCCTCAGCTTGACATGCCCGTTTAAGCTCTGCTACAGGACCCAGGACAGACAGCACATGG
CTTAAGTCCTTTTCTCGACCGGCAAGCGGAAACACAGGTGGGCGAGTCTTATCTCGCACTGCCTTCCGCGCGCGCTCTGCAAACCATTCTTCAAGCGCCG
GCCACTTTTCCAGAACTCGCCGGATAGCGTTGGTGATACTCAGAAATCGGGCGGAGGAATAGTTCAGCAAGCGCGTCGTGGAGGTCTCGGTCCTCGAGTT
GCATAGTGCTTCGAAGAGATCACCCGTTACTTCGACCGTGCGTACTTGGTAGATGGTTGTAGTTAGCTGCGTAATTAATTCAGTCATCTCTGGGTTCTCC
TGTTTTTTCTTGTCGTTCATACACACGCAGAGCGAGTTGCGGCATGAGCCATATGTGCCATGCACCACTCCCATCGTAGCTGTAGTTCATCCGTCAGTAG
ACACCTCACATCGGAGCCCTTGTCGCTCGTGGCACCGTAAAATTCGAAGTAGTCAATCGAAAGTCCTCCAAAGCGCGCTTCATCCATAACAGAAACGGCC
TTCTGATACCTTTGTCACGATCACCGTAAACTTGCGCGTGCCCAGCAGCAAGGACCTGCCAATTCCTGTCAATTAGGTAGACACGTAGGCCAAGGTACTT
CTTCGACGTCGTTTTGCAAGTCCAAAAGTCTGCCATCATCGTGAAGTTCGGGTACACCTCTTTGTTGCTCTAAAAAAACTCGGTGATCTCCTTCCTCGTT
TCGA