Description :
From Genome Similarity Track
Location :
Scaffold_129:2309- 3555
Sequence
1246 bases(100 bases per row)
GTAGCAGACTTTGAGGGCTCGGAGCAATGCAACGATTTCTTTCGCCCACTTCGCCATTCGTGGTTCACCACCCTTGAGAACTCTTCCGCAGAACCGGACT
GGATGCAGAATGCCGCCATGTTCTTGGCACAGCGTTGTCGAAATTGCCCAGTCCGTGACGTACAGCAGGAGGTGGAAGGCCTTGGACGGATCAGCGTGTC
GTAGGATTGGCATGGACGAGTACGCATACTTCAACCCCTCAAAGGCAGCTTTCGCAGTCTCCGACACTTGCCCGGCACGGAATTCTTCGTCGGAGATTTC
GTACAAACACGCCGCCTTGATCGAGTAGTTTTCGATAAATCGAGAGTAGAAATTCAACGAACCCGTGAATGACTGCATCTCACGCAATGTTTTGGGGAAG
GGCATGTCCAAGACTTGTTGTAGTCCCCGTGGTTTTGCTGAAACCCCTCGACTGGAGATGATGTGGCCCAGGAACTCTGTAAAGCTCTTCCCGAACGTGC
TCTTCTTGGCGCTAAGGCTGATGTTGAAGTAGGTTAGGCGCGTGAGGATGCGGTTAGTGAGTTCCACAATGCCCTCCCAAGTTGGTGCACCATCCCCGAT
GTCGTCAGCAAAAGAAGTTCGGTTGGCGATGGGCAGGTTGGCTTTGTCTTCGTAGGTATGATTCAATTTGAACATGTCCCGTGGCTCTCCATCTTCATCA
AAATCACTCAGACCAGGCGGCATGTCCACGAATCCATAAAGGGCGTTCGTGATCATCCTCTGGTAAATCATCGGGGCGTTCTTGAGACCTTGGGCCATTC
TTGTCCATTGAAAATGTCCTAGAGGGCAGATGAACGCACTGACTAGTCGGGCACGTAAGCTGGCCAACACCACCCAAAATCCACTGGCATTGTCCAAGGA
GAGGAACCACTGTAGCCCATCGAAACCCGCCAACATCGAATCCAAGGTGGGCATTGGGGACAGCATCAACTCCGTCAAATCATTGATGACACGATAGTCA
ATACACAGTCGAATGTCGTTGCCACCCTTCTTAGGTACAATCACAATCCGGGAGGCCCAGGGCTAATTTGAGAACACGATCAACCCATGTTTCATCAGGC
CCTTCAGGAGGTCGAATAATTTGGGCATGTACTCTGGTCGGACCCGGCGCGTACGCCCCGCAATAGGTTTCGCATTCCCGACATCGATGTCACACACAGT
GCCACGGGCGGCGGGGGGGAGACCATTTCCTGAGCTGATGAAGAAG