Description :
From Genome Similarity Track
Location :
Scaffold_127:23088- 24914
Transcript NameFunction/comments
Aphas_H257_17962Hypothetical protein

Sequence
1826 bases(100 bases per row)
TATCGTATCTATCAGCGATGCATGCATGGCATACACGAAATGGACTGATGTTGTGTAGGAGCATTGAAGAAGAGCTCAAAGTGATCAAACACCTTCGGCG
CCATGCCGTGTATGCGTTTCTCGCGCGGTGGCAGACGGACCTGCGCAAGAGACTGCTAAGCTTGTGCTTTTACATCAACTTTGTGATGCTGTTGCTGCTG
CGGTGGGACCAACCGGGCTCATATTTGTTTCTCCAAGTACTCGGCGCCGTCTACTTAGCTGGGTCGCTCGTCCTCCTCGGGTTCTACGTGACCAAACAGT
TCAACTTTAACTATTGCAAACAGCAACTTTCCCTCACAAAGCTGCACTTTCGATCGCCCAAAGCTATCAACGACCGCGTGTGGGACGCGTGGCAAGGCCC
TATCCAGTGCTTTGGTTCGTACACCCTCGATATATATATATATATATTATATATGACCAAGTTCACCCTTATTATGAGACTTTGAAAAATACCAATGTCT
AGTTTCCAAAGACGAACGACTACTTCATGATATGTATGATATATTTCTCCACTATATTTCATTTTTTATATTTTTTAAATAGAAAATGGTTGTGTATGCT
CGTACCCACCCAACCACATTCTTGTGATATATAATATTGATATATTGTTTACCCAACCACTTTCTTGTGATTTATAATTATTTGATATATTGTTTACCCA
ACCACATTCTTGTGATATATAATATATTGTTTGTACATATTTTTTTATAGAAATCATTGCGTGGACCGTGTCGCTGGTGGTATATGTGAATGGATGGGAC
ACGTACGGAAGCGTGACATGCTGCTCGGTGGCGGCGGCCGCGCTCGTCCTTTCGACCCTCCGCGCCGTCCGGGAAGTGGCCAGCGTGTCTCGGTTCTCCG
TCAACTCCGAGTCCTCGTATGACGAAATGAAGGTCAAGCTGGGGAATCGCATGCTCAAGACCAAGTTTCGATTCTGGTACAGCGTGATATACGACACTCT
GTTTTCCGAAAGCGTGCTGGCTTTTCTGGCGTACTCGACGTGTGGGTTCCTCGGGCTCATTGCGACCGAGAACCGATACTTGTACTATGGCTTTCCCCTG
CTCGACCTCGTGGCTATCAACGCCGGGCTGCGATTTGTCGTACGTCGTTGCTGGCAAACTATGGGCATTTGATATGGTGTGGCTATTGTAGGTCAAAGCC
ATGACAACCAACACGTCCAAGCTGACGGTCACGGCAGTGTTTGGGGCTGTGGTGATCTACGTATTTGCGTTGAACGGGTTCTACTTTTTCCAGGATGAAA
TGACCACCGAGAGCGGCACCCAAGAATGCCACTCGCTCATGCAATGCTTTGTCACCCATGTCCACAACGGTACTATGACATACTAGTAGTATCTACTACT
AGTAGTGTACTAACAACCCACCGTGTCGCAGGGCTGCTGAGCGGCGGCGGCATTGGCGACTACATGTCGCACAGTCCGTTAAACTACACAGTCAAGGCGT
CGTATTTTGGGCGTGTGGGGTACGACCTGGGGTTTTACGTGGTGGTGATCGTGCTGCTGTTGAACTTGATCCAAGGGATCATCATCGATGCATTCACGGC
GGTGCGCGAGGCGTCCGAGAACAAGATGACACTGCAGCGTCAGCAGTGCCTCGTGTGCAATCGGTCGCGGTCGGTCATCGAGGCCGAAGGCATGGCCAAC
GGTGTCATGAACTCGTTTGCGAGACACACAGACACCAAGCACAACCTGTTCAACTACTTCTTCTTTGTCAAGTACCTCAAGGCCAAGGACGACACGGACA
TGAACGGCATGGAGTCGTTTGTGTTT