Description :
From Genome Similarity Track
Location :
Scaffold_39:230808- 231945
Sequence
1137 bases(100 bases per row)
nnnnnnnnnnnnnnnntgatttaccaatagataagtgctttgtaactgcgcacaaatactagaatcagtcattgcgtccgggggagataatacttacaaa
ctcccccgtgtttcgaagcaccacattcacaaggaagttcactcccttgtaacccttcaatatacaataggggctggaagcgctcaaaataatggaatcg
caaacgacgaccgagtattttttatgtcaacaaaaggtcttttttagcacacattgttttatttaattttgtcttgtgtttgacataattcttaggatgc
tgtgaatcaagagctctcattggttagtatatatatcgaacgcatcgtaaaacagacagcgaattttctgttgacactgacacatctggtaaaacatgac
attaatagattgcgtttaaaaacgcgacgtttttattgcacttttaagctcaaagcgaattaaacaaattaccctgtcaaatcgaatgccatcattttgt
ttttcacttcgtagccacaagctgacacgagtcattaaaaatagaggttgtagagcatagccatagctatatatcaagacctcataaagcaaaatcgcac
cactagttcgcacgtgacatccctaaatgcaatatgttaagtttgagatggaacagagtagtatctctttttcgaaatacgggaatatcggcgaaatcca
tgataacttaattagcagacaactacgaatcacgttgggtattaggggcatcagcttcggcgggatgacgcttaacgcggtggaagactaagacattcga
ggattgtgcgacgatgctcaaagcacacatacctgctgccaatttgtgccggaacaacctgtgaaaacgttccacatttcggcacataactacagagata
agaagaaggcaagtttttgcagttctatgttcgaagtcctggaactagggcgaagcactgactaacgattggtgctttggcttaatattctaacgcttaa
atgtttgttggtttttgtgccgccttgatgttgcttagccgtcctggcgtaatttggaatcctgagcacctatcgcatagttttaaggagtgcggtatgc
gcacggtgtgttacatgcgccgtgtacaggagggcga