Description :
From Genome Similarity Track
Location :
Scaffold_6:23079- 25302
Transcript NameFunction/comments
Hyaar_Emoy2801215hypothetical protein

Sequence
2223 bases(100 bases per row)
CACAGAGATCTGATGGCCGAGGGATGGTTGTAAGAGGAAGATGAGTATTCGTATGTACCTGCTGAAGGCAAAAAAGTGCTCGTTTCCATTCCTTGTCTGA
CCAATCAGGGACTAAAATGTTCGTTTCATTTCTTTGTATTGACCTATCAGGGCATCGTAAGTGTGAAGGGAGGATAGTTATGGCGAGGGGGTGGATGCTT
AACGCCTCCCAATGGGAATTCTTATTTTCACTTCCTGAAGGTACAATTGGGGAGCAAGTTCTGGAGCTCACTCTTTGATATTATTAATTCAGTCCATAGA
ACTGAATCATGCTCTGTATATTCACGTACCTTGCGCTAAGTCATTATATCGGCACCCTTCGGGCTCGCAATAATGCCTATTAACAATGAAGAGGGAATAA
TCGCTACACACTTAGTACGACGCGAAGGGTACAGCTAAGGTATTAGGCCAGATTATGGCCGATAATTGGTAGGAGCCGATCATATACTAAAGCCATTTAA
CCTGAGCAATTTGGTTGACTTGATTAACGAATGAGTCAGTATATGGCCACCCCCACGCATCAAACTTAGGTTGATCACATACTGCAACAACGCACGATGA
AGAAAAGAAAGGTGCACAGCCAAGACGATCTCGTGAAGGCTTTCAGTGCTCGTGAACAAAATTGTCGTTAGACACAATTCGTAAGTTGTTTCCCACCGTT
CCAGAAAGAACGATCCGCCGCCGCGCTACGCAACATCGCTCTATTGTGGCAATCAAAAGGACCGGACCACCGCCCTCCTTTTCCAAGAAATTGAAGACGA
CATCCAGACGTGGATCGTAGGGATGCAGCGAGAGGATATCCCTTCTACGCGTGGGATGGTACTCAGCAAAGCAAACGAGGCGTACGTGCTTTACGGTCCC
GCACGACCGGATAGGCTCCTGGGCAACGGATTTGTCAAGCGATTATTTTCCCTTCACCCCAAGCTTTCACTCAGGGTCCTTTAAGCGATTTCTCGCGCGC
GAAACCAAGTCCGGAAATAGAACCTCGATCAACTTTTAAATCAGCTGATTAAGCACGCGATTGAGCGCAAACTAACCAGTGACAGCATGTTCAATATGGA
TGAGACGAGATTTGGTCAGAAAACAAATTCAAGGAAAGTCATCGCTGTGCGTGGGTCAAAGAACGTTTGGACACATTACATCGACATTAGCTTTCATCTG
ACGCTAGTCGCCTGTGTCAGTGCCTCCGGAAAGTGTCTGCCGCCGCGCTTCCTGCCTCTCTACAACAATATTTGAACCGTGACATCTTGAGTGAGTGCAT
CATCCCTTCTGCCACAATCACTGTCGCTTCGAAGGCGTTCAGGAACCAAGCGATCGTCGTCAAGTCTTTGGAACACTGTTCGCAAAGCTTTACCCAGCAG
CGTCACTAGGCCACTACTGCTCATCTACGATGGCTGTGCGAGACATTACAGCAAGATATTTGTCGGGAAGGCGATCGAGACGAAGATTTTTCTATTTTCT
TCCTCCAAAGTCCACACACTCCTTGCAGCCCTTTAATGTCTCCGTGTTAAAGCCCTTCGAGACCAGCATTCGTCGCTCCATGGACTGCTTAATGATCAAT
AATGATGTGTCGAGCTTGACGAAGAAACAGGAAATCTCACTAGCATCGAGCGCGTGGCAAAATATTGTGCTTGTCAAGCCAGACAATGTTATTTCTGTCT
TTGCAAAGAATGACCTTGTCCAATCTCAGCACCCAAGATGCGTGCTCGGAGAGAATCATACGCCGGTGGAGGTGTTAAGAATGGAAGCTTACCAAGCAAA
TCGGTGCGAGTCACAGTGCGACCAAAGCTCCGTACGGAGGTACTATTCCTGCCGAAGTCAACAGCTAAATGCAAAGGAAAGCGCAAGACTGTTGACATTC
TTGATCTTTTCATGACTCAAGAACAGTTGAAACAGATCAAGTGATTTAATTAAGTTTGTATTAGATTTGATATCGGCCATATTCTGAGCCATTAGCAAAA
CTTCCAGAATTTTTGCCTCTTTGGTCTGTTTCATAACTTTCTTTCATTATGATTCTAAGCATGAAGGTTTGCTGCAACGGCTAAGCTACGGTCTTCCAAT
TACTTTGAGCTATTTCGGAGCAAAAAACGAAAATTGAGTCAACAATGGGTTTTAGCTAAGATATACGTATATCGGCCATAAACCAGTATCATACTTTAGT
GTTTTTTTTGCAAACACATGCAA