Description :
From Genome Similarity Track
Location :
Scaffold_3:2307840- 2310752
Sequence
2912 bases(100 bases per row)
TGGTGTCGCAGCTTTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGATATGGA
GAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGCCAAAACAAGTTGTACGCCAACATTGACAAATGCAACTTCGGAGCGGAAGAGATCCCC
TTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGGATCTTC
GCAAGTGGCTTGGCTTGGCCAATTACTTGCACAGGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTTTCCAATCTCCTGAAGAAGGATGCGGAGTG
GTGTTGGAACACCGAGCATCAAGATGCGTTCGCGGCCATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTTTGCCAGACCCCGCTCGTCCGTTTAGT
GTCGTCTGTGACGCCTCGGACTTTGCCATCGGCTGTGCACTGCTACAAGCAGACGCCGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGG
AGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACTAGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTT
CGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTGTCCTTCTTCGCGGAGTACAAC
TTCGAGGTGAAGTACAAGCCTGGCAGGCACAATGTCCTTGCGGACGCGCTGTCGCGCAGGCCAGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGT
CATTACCGGATCTGATCCGAACGGCTTATGCCAAGGACGACACTTGTGTCGCGTTGCTAAAGGCTCTGGGGAACAAGGAGTTTCAAGACTCGGACATGGA
ATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGATCATC
CCTCATGATGAGGATCTGAAGTACCGCATCCTCTATGAGGCGCATGACACGCCGCTGGCCGGCCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCA
CCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTCAGCGCGTGAAGTCGTCACCTCATGCTGCAGCGCC
GTTGGCGAGTTTGCCTGTTCCTTCGGGCTGTTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCTGACACGGCGGGCAACACTGAAGTCGTG
GTCTTCGTGGATCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAATGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTC
GACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGGCAATTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGA
CATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACAGAGCGCGTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCCGAGACGCCGAAG
CGCTAGAGCGCCATGCTGCTACTCGTTGAGTTTGCGTTGAGCAACGCCGTGCACGCCTCGACAGACTACACGCCGTTCTACGTGAACAGCTTGTCTCATC
CCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGACTTAGCTGATCGGCTAGACGATGTCAGCCCGGCTACAGT
TCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCATACGACATGTGCGTGACACAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCA
GATGCCAGGGGCAGAGACAATGTTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCTAAGAACTACCTACACATGCAGTGTCTGCCGTCTTCAA
GACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATACGGGCGCACCCC
GTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCCGATGCAGGTGCAGATGGAGGCACCGAGGGTGACGAGGTCACAGGCGCGGAGGCCGCACTCGT
CGAGGACGCAGTCGCAGGCGTCGAGGACGCGGCCATCCACGCGGGCACCGCAGGCACAGGCGGAAGGATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGA
GCCGCAGGCGCAGGCGGCGCAGCAGTTGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGTGCT
CCCGGCCACGCTGCTCGTCGCGATCGCGATAGTATCGCACCCAGTCCTCCAGGGCCCCAAGGCGGTCCCAGACCTCTCGAGGTACATCGATCCATTGAGT
CCGCTCGGCGAGCTGGTCGAGTTCAGTGGCAGTCCGGCCCAGACGCGCACCAACGTCATGGATGTGATCCCGAAGGCGGCTCGCCTGCTGCCGCGCCTCC
AAGAGCTCACCTTGAGTCGCAAACGGTCCCCCAGCGGCCTCCACCGGCTCTGCTCGATGAGCATGGGAATCTGCATTACCATGTGGAGCGCCTCCTGGCG
AAGCGGCGGTGCTGGGGTCAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTACCCCTCCACCAGGACTG
CCCAGACGTCGT