Description :
From Genome Similarity Track
Location :
Scaffold_7:230754- 233405
Transcript NameFunction/comments
Physo_564329metallophosphoesterase, partial

Sequence
2651 bases(100 bases per row)
ATAAACTTCTTGGCACCTTGACTTGGCCAGCTTCTCAGTCGTAAATGGGGATGGCGTCAATTCTTTCAGACGAACCAATGCGGTGATCTTTTGGTCCTTC
CAACGAGCGAGACGCTCCTTTGCGAGTTCGTAGAGAATTTAACCAAGAAAAGTACATGTAGATCTTCCTTAGTGCAGAGCCAGCCTTGATGCAACGCTTC
CATGAAATAAAAGTCCTCACCCGGCTAATATTCGGTAAAATCCGTTACTTCAATCTGAGCATTGGGAATGAAGGGAATATACGATTGCCGGGAGCCGTTA
TCTTCTCTGTCACTGACCTACATATACGGCGGTCTTAGTACTCACTACTGGGGGAACGCGGCTCCGCTCGGCTTCTTCTGGTTTCAGCCTTGGTGACGAG
GCCAAGGGTCATTCATGGTCATGGGATTTACGATGAGCACTCCTCGCCCTTCGTGCCGTCCGCGGGGATGTACCAGCAGTGCTTGGTCTCGACACCGCCG
ACGGTCGTGGCGCTCATGCTCGAGCCGAACGACCACGTGTCGTCGGCCGTGTGGTACTGCAGCTTGAGCCAGTCCTCCGAGGCCGTGAGCGAGAAGAAGC
CGTACTCGTCGCCCGTGTACGTCCACACGTTGCTGACGTAGTCGGCGGCGTACGTCGTGATGCCGCTGGCCGACTCCTTCTGGATACCGCCGCCGGCGCC
GTTCTCCACGAAGTGCACGCCCAGCGTCTCCGAGTAGTCGTGCTTCTCGCCGTGCGTGTGGCCGTAGACCCACGCGTGGATGCCAGAGCCCTCCAGGATG
TCAAACCACTCCTTCATGCCCGTCTCCGCGTAGTGGACGCTCGGCGAGTAGTGCGAGTTCACAATCTTCCAGGTCGCGTTGGACGTCTGGACCTTCTCGG
CGAGCTGCGAGCGCGAGTCGTCACTCCACTCCGTGAACTTGGCGAAGCAGGTGTCGTACATGTCCGTATCACCTCCGCAGCAGTACTCGTCTCCACGCGC
AACGTTGTTGCACGAGTCGTCGTCGCCGTTCGAGTAGCCGTAGCACTGGCAGCACACCTGCTGGGCCGCGTGCACGTCGGCGTCGCCCGAGTCCACGTTG
AAGATGTCAATGCTGACGCCCGAGTCGGCGTCCTCGATAGTGTACACGTAGAAGTGGTCCTTGAGCACCCAGCGGTCGTCGTTGGGGCTCGTGTACTCCT
GCTGCCACTTGAACTTGTTCTCTAGAGCCGTGATGAGGTCGTCCGTGCTGCCGCACTTGGCGTTGTCATCGCCGTCCGAGCAGATGTAACTAGCGCCACC
GTAGTCGTGGTTGCCCAGCACGTTGATGAACGGGATTCCAGCGAGGTTGTCGCCGTCGAACTTGCCCTCGAAGGTGGTGGTGAAGCGCGAGTCGCGGCCG
TCCTCGCTGTTGATGCCCGTCCAGTAGAAGTTGTCGCCGTGGCTCAGGATGGCCTTCGGCTTGACGTCGGCGTTGCCCGCCTGCGTGTTCATGAGACTGG
ACACCACATCCTCCGCCACCACGTCGTAGTTGTTGTACGTCTCCGAGCGCGTGCAGCACGAGTCCTTGGTCACGGTCGTGCCCCAGTCTCCGATGGCAAA
GGCCGCAAGCGAGTAGGTCACTGCAAGAAATCAGAGAAAATCCGTCATCAGCCTCCTCAACTCCTCTGCCATTTGGGGGGTTGGATTGAACCGTACCGGA
GGTGGGGTCGGACGTCACGGTGGACGTGACCGTGGAGCTGCCCGAGGTCGAGTTGGACGACTTCTTGCTGGTGGACGAGCTGGTGCCCGAGCCGCTGGAC
GTCGAGTCGCCGGCGTCGCCCGACTCCTCCGAGGACGTGGAGGATGAGCTGGACTTGGTGGCCACCAGCACGCCCACGATGGCGCCCACCACGGCGCACA
GTACCACGACGCCCACGATGATCAGGCGCTTGTTCACCGCCATTTTCCTATGTATCTGACTGACTGTCGGCGCTTCCAAGAGATCTCCTTGTCCACTCGA
CGCGAAGTTGGCGAATGGGTGCCCATGGCATTGACCCACGGAACCAGATTCCCGATCCTTGGAAATTACGTGACAAGGACGGAAAGGTTGATAAATTGCG
TGAAATAGCCTTGAATTGACCAAGGCTATTGTACTCCGAACAGATCCTCCGGACAGAGAATGGACGGGTTTCGACAAAAATGGCTCAAGATCATCTGATT
TTTTTGCCAGCTGCGCCGATTGGCTGAATTATTTGCAAGACGTAGCCTACCCTAACCAGGCGATTAAAACGTGTCGCACACACCATGGAAAAGACCGATC
AGCAAAAATGAGGTCGGTGGCTCTGGGGCCCTGGGTTGTCCACGCCGCTATCCAGCAAGCGAAGCTGGTGAAAGGCGTCGCTGCAGTGCGAAATGCTGGT
ATGAAAGGTGGAAAATTGCAATTCGACTGCCGCTAATAGCGATGACACGGCAGTCCTGCACGTTAATCTGCGATCCCACAGGATGCTGGAGGAATCGCCC
AACACATGGTGGCCGCGCTTCAAGTCCACTACAGTATTGCGGTGCAAGTCTCGCATGGCATCGACAACACCGAAATAATGTGATACTGCATCGGTACTTT
CGCACGGATATATCCGATCCACTTCAGTTCCCCTCCGCACGTCGAGTCCTT