Description :
From Genome Similarity Track
Location :
Scaffold_99:23072- 26576
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_99-snap-gene-0.22F-box and wd40 domain protein
Pytve_DAOMBR484maker-pve_contig_99-fgenesh-gene-0.12Tetratricopeptide repeat family protein

Sequence
3504 bases(100 bases per row)
GGCAATGAAGTGTGCCGCCATTTCATGGACGCCGGCAAGTGCTCGCGGCAGCCGTGCCGCTACCCTCACTTGCTCAAGAAGATCGGCGAGACGCGCGGGC
ACAAGGGTGCGGTCAAGGACGCCGTCATGTGGCCCGAGCGGCAGCAGTTGCTGACCGCGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGCACCATCAAGCTATGGGACTGCGCGACGTGGAACGAGATCACGACCTTGCCCGTTGAAGACGGTGCGACCGGGGCTTCCAGCAACGGACTGGGCAG
TGCCAGCACCACCGCTACCCACAAAGAGGGCGTCGCGACGCTCGTGCTCGCCGGGTCGTTCCTCTTCGCGGGGTTCGACGGCGCCTTCCCGCCGAACCCG
ACCGTCCACGTGGGCAAAGTGCGCGGCTGGAACCTCGAAAACCCGTCGGCGCCGCCGTTCGACTTCCGCGCCAGCGACGCGCTGCCGTTCGCCCACCCGC
TCCACACCTTGTCGCTCGCCATCGCGACTGACGCGCGCGGCGCGGCCACGCTCTTCAGCGGCGGCGCGGACGGGTCGATCCGCTANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCTTCCAGTGCCGCGGGGTGCTCGAGGGCCACGTCCGCGGCGTCACGCGGCTCAAGACGTTCGTCGTCGGCCAGTCCTCCAT
GTATGTTCATCGTACTGCTGATGCTGGCGATACCTCTCTCCCTGACTGACCGACTATTATCGTCGTTACAGCTTGGCGTCGGCATCGGTGGACGGCACGA
TCCGGCTGTGGGATTTGAGCACCTTCCAGTGCGTCAAGGTGCTCGGGCGTGACGAGAACGGTCACACGGACGCGGTGATGGACCTGGAGTTCTGGGTGAA
CCAGGGCGAGACCTTCCTCATCAGCGGCGGACTCGACGCCGAGGTCATTGTTTGGAGCCTCGCGCCGCCCTTCCAGCAGCTCTTCCGCGAGACGCAGGAC
GCCAAGGTGACGGCGCTCTGCGGGACACAAGACGCGGCGCAAGCCCCCATTCTCCTCATCGGCAACACAGACGGCGCCATCACTATCAAGGAGCTGCCCA
GCTTTGCCTACAAGACGACGCTCGCGTACAGCGCGAACCAGGGCCACCAGGACGCTGTGCGCCGCATCGCCACTGGCCCGCTCAACACGTTCTTCTCCAC
GGGCAACGACCGCCGTACGCTCGCGTGGCAGCTCACAGGCGACGTTGCAGCCATCCAGCAGAGCTGAGGCGGCGTCGACAATTCTTCAGGACGCGATGGG
CATAGAGCCGCGAGCAGAATAGGCAAAGCAACGCAGGCTGTAGTAACAGAAGGCCGCGGACCACTCCTTCATCTATATAGAGGCGGGCGGGGCTTGTATC
TCTGCGCATCATGATCCATCCAGCTCTCTCTCTCTCTCTCTCTCTCTACCTCACAGCGTCACGCTTCCTGCTGGAGCATCAGGCGACACCGTGACTGGCG
TCTCGGGACTCGAACGACTTGAGCGGTGCGAAGCTGTCTCTTCTTCATGCGAAGCTATAGCGAGTGCGATCTGCTGGCGAGCGGAGAGATCGCGAGTCAG
TTGCTGATGCTGAGGCTGCAGGTCGCCGGCGACGGATGGCCGCAAGACTGGCGCGGCAGTACTATCGACGGCGGGAGCGGCGTCGGCACTCCCACCGCCG
TTCAACTCCTTCCGCACACGCTGGAGCCACGTGGACGCCTTCTGGTACGACGGGTTGAGCGTGTAGGCTTCTTCGAAACACGACGCTGCAAGTGCGAGCT
GCTTCTTGCTGTAGTGGCACAACCCCATGTTGTGGCTTGTGACGTGGTGCTTGCCCATTTCCTGCGTCGACAGCGTGTAGAAGGCGAGCGCGGCGTCATA
GTCGTGCATCCCATAATGAAGCCGCCCGATCTCGAACGCGATGTCTTTCTCCTTGTCAAGCGCGTAGTAATTGCGCCAGACAAATGGGATCCCGCAGCGC
ACGTCCTGCTTGAGTTTGGGTGACGCGCCTGGCGAGTGATCAAGCAGCACGTCACGGAACTTATAGAACACGTCTGGGTCCCATCCACTCAGCTTCAGGA
GCGCGAGCACCGACTTGAGTGATGGCACCTTGGCATCCTCCTTCACGGCCTTCTGCATAACGAAGAAGTCGTTGGGTCCAAACGCTGCGATCTCGTCCTC
GAACGCGCGGGTCAGGTGCGGGTAGCGCTTGCTGCGCTCGACGCACACCGCTTCCAATCGATTGCCGAGCAACTCCGTGATGGAAGGCGCTGTCGGCTCG
GCATCGTAACCCGGCAACACGAACGCCGAGACCTTGAGGCTCGCCTCTTCTTGCGAGCTGTGAAGCGCGAAGCCGCCACGACTGGCCACGTAGACGCCGA
TGGCATGGTAGTTGACCATGACGGAGAAGCTGCCGTGGATGGCAATGTGTGGGTCGCTCACACCACGGAAATGGTCGGGGTGGCTGTTACCCTTGTCGCC
GCTCAGCACCACAACGCGGCCGCGCGAGAGCTCGCCGAGCCGCTTGATGGCGTGGAGTGCGCCAATCGGCACGAGAATCGTGGCGCCGGTCGACGCTGGG
TCGTAGAACTCGTGGTACCATTTGAGGATGTTGTTCAGGTGAGGCTGGTCAGCGCCGTAGTAATCATCATCGATGGGATCGTATCGGAACTCGTTGGCGA
GTCGCTTGATGATCTCTGGGTCCAGCGGATCCGGCTCCTCCGTCCGCTTCGAGCCAACACTGACGAGTCCCTCCTTGAGAACGCCGCGGTCGACTTGGAA
CAGGTCATGATGCAGTGTATCAAACAAATAGTTGGCCACGATTGCCAGCGGGTTCTTGAGCGTGTGGGGGAGGAGCACCTCGCCCGAGTTGGACAGTCGC
AGCTCGGCATCCCGCGTCGCGTCGAAGATGGCAAAGTCCACGAGCCCACGCCGCACAAACGGAGCGAGCGCCGGGTGGGTCTTCCAAAAGGTAAAGTTGG
CCTCGGTGAAGTCCGTCATAATGTACTTGATACGGTCCAGCGGAAAGTCGAGCACGTCCTGAAAGCAGCAAAACAAATGTGTGAGACTATCTAAGCGGTT
CCCACCACGAGTAATTTTGAGCACTGCGCTCTGACCTCGGCTTCGACGAGTGCCTTGAGAAAGAAGAAGCTGAACTTCCCCGAGCCAGTGCCGAGCTCGA
CGATATACAGTGGCTCGGTCGGGTCGAGCTGCGTTCAATACCAATTGTCAGGCTACAGGGATGATCCAGCTCCACAGAGTGAGCGCTATCAACGTACCGG
CGAGGCGGAGGTGGAACGCGTCGCGTCGCGAAGGAACGCGCGCAGCACGTTGCTGTACCGCTTGGCGATGAACGCATTGGACGTGATGAAGTGCGGGACG
ATGCCCTGAGCCCACGACTCGACCCCCTGGCGGTCGTAGAAGCTCATCATGAGTTTCCACAGGTGCGACTGCGAGAAGCGCGTAAAGTCCTCGAGCAGGC
AGCG