Description :
From Genome Similarity Track
Location :
Scaffold_327:2307- 10283
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_327-snap-gene-0.12Flagella-associated protein FAP196
Pytul_var.sporangiiferumsnap_masked-pug3_contig_327-abinit-gene-0.19F-box protein
Pytul_var.sporangiiferumsnap_masked-pug3_contig_327-abinit-gene-0.2780 kda MCM3-associated protein

Sequence
7976 bases(100 bases per row)
TGTACACATTCCAGATCAAGATGCTGCCATCATCTCCGACAGACACCAACTGGCGGTCATCGGGGCTGAATGCGACGCTGCGCACGTTGCCCGAGTGGCC
AACGCCGTCCAGGAGCAGCTCACCACTCGTAAAGTCCCAAATCTTGACGAGACGATCGTTGCCGCCAGTCGCAAAGATGTCGAGGGTGTGTGCAACAGCG
ATGCACGTGGCTTCTTCATCGTGCGCCTTGTGGATGATGTGGACAGGCGACTCGATACGCAGGTCCCAGTATGAGATGCGCTTCTCCTGGCCGACGCTGA
GTACGAGCTTCTGGTCGTTTGAGAGCGCGACTGTGTTGATGCCGCCCATGCGCTGGATGTGGCTCGAGATGCGGCGCTCGTTGCGCAAATCCCAGCACAG
AATGCTTCGGTCGCGGCTGCACGAGAGCACGTGCATGTCATCACCGTAGAGAGCCAAGTGAGTCACAGCCATCGCATGCTCCTTCAGGTGCGAGACCATA
TCGCGGCGACGGATATCCCACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGTGACGCCGCCAGTGTGCGCATTATCGATCGACCACACCAGATGGCCTGTGTCGGCGCTATGGCATCGAATCGCACCATCAGTCCACCCCG
TGAGCAGCACGTCCAAGGAGTACTGGAGACACGTCGGCAGACCCGCGTTCGTGACACTGCACTTCGTGGTCACGGCGTAGTCCGATGCGTCCCAAACGCG
AATCGTACAATCGCGTGAGACCGTCGCAAAGCGGTCCGAGACGCCAGCGGCATACGCGACTTGCACAACGGCGCTTNNNNNNNNNNNNNNNNNNNNNNNT
GGTTCTCAAACAATAGCGACGCATGCAGATTGCGCTGTGCCACGCGCAAGGAAACGACAAAAATCGAACCTGCTTGGGTACCTACGACGGCTTCGGTCTG
CGCCGCGTTGAGCGCCAAGCCAGAGACCGCAGCATCGAGGAGTACGTGGCACGTATCGACGTAATCTTTGTCAAAATGCAGCACACTACCGTCGCCGCCT
CCGATGAGCACGCCAGCATCAAAGTATGCAATCGAGTGGATACCGCATGAACATGCCGGAACATTCTTGACCAATCGTTTAGTTTTGACGCTCACGACCG
AGAAATCGCCACTCGTGCTGCCAGCAACCAGCGTTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTGTAGTCGCGCACGACGCCCTGCTCG
ATCTTGTGATTCACGAGCTCACCCGACATCGGGTTAAGCACCCAGAGCAGCAGCATGCGGAGACCCGCAGTCGCAAACTGGTAGCTCGTCGTGGNNNNNN
NNNNCTTAATGTCGCGCGCCATACCACCGAACGCGACTGCCGTGGCGACGGTACTCAGTTTCTGTTGCGTTGCACAGATATTGCCCGTGGCGACGTCCCA
GATGTACAACCGACCGTCTTCAGGCACGCCGATCGAGCACAACAGCCTCTCGTCGTCGGAAAACGCAAGCGCCGCGATTCCGTGGTCGTGCTCCGAGAGA
CGGAACTGGAGGCGCTTGGACGCATAGTCCCACACGAGCACATCGGCGCTTTGCTTACCACACTCACCAGATGCTAGCAAGCGACCCGATTTCGATAGTG
CAAGGCATGTNNNNNNNNNNGGAGAACCAACTGGCTGTGCGCGTCCTGGAACGAGGTCACGAGAATGGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGGGTACAGATACTCCAGACCCGATGGATGGTAGTGGATCGCATTTGGTACGGTAGAGAACCCGATCGTGTGCTCCAGTTCGATCGCTGGCGA
TCCCGAAGAATCTGGCGAGATGGCGTGTTTTGTCTCTTGACGCTGTCCTGCAGCAGTAGTGACAGCGTAGACAGAGCCATTGATGTTGTTGTCATACTGC
ATGGTTACCTTCGCAACGCGGTTCTCGCCTCAGGCTTAATACTATCAGGGTCTTGGCGTGCTTTGATGATGTCGACTGGGTCTGAAATGCTTGCGAACGT
GTGCGAATGCAGAGAAGACAGAAATACTCCACTCTATGATATGAATAGCGTGCCTCACTAACCACTTTTGACTTTTCCTCATGCACACACACCGTCCAAA
GCCACCACACACACAAAGCACACCACACAACTCACCTACCGACCACGTAAAAACCACTTGGGTTCTTCTACAAACGCTCTTATTAGTAATGTACGTCGAA
GCTGCCAATATCGATCAGTCCTCGTGTCCCCACGTAGCTCAAGCAGATGTAATACGGTGGTAGGTGCTCCGCGCGATGCCACTCGAGCATCTGGAAACCA
ATGTTTTGCTGCCGGTCAAACATGTTGAGACGCATCACGCCACGCGCCAGAAACACACGCCGCGACAGCGCAAATTCTTGTAACTAGAGAGGAGTCATAT
AGATAGGTTCGTCAGTATCCATGCGAGTATTTAGAAAGCCATAGCGCATCCAGAAAATACCTTCATGTCCTGGATCGCGTCGTACTCGGGCGACTCGTAG
ACCACGGATCCAAGCACTTCGTTCCCATCAGCATCACGCGACAGCTCGTAGAATGTGAATGAGAGGCGCATTGGCGAGTACGTTGGGTTCCCAGGGTACC
AATACACGCGGTACGGCGCCACGAGTACGCTGCTGATCAAGGAATCTGGTGCCGTACTGTACTCGATAAAGTCATTGTGGCCATTGTGTTGCCACGACGC
CGAGCTGGTTGGACCAAACAAACAGAAAGCAGCGAATTAGGCATGGAGGTCAACAAGCCAAGGCTTAGTATCAACAAATCCACAGAACGTACGTGCTCCA
GTAGCACGGTCTGCCACGTGCGCAGCCGCACTTGAGCTGAATGCGCTCCATCCACTCCTGGTAAATGGCTGGCTGCTGCGCGAGGATGCTACGCGACAGG
AAATTCACTTCGATTTCGCACGACGACCGCGTGAGCGTGTTCTCGGGTACTTCGGCCGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACGGACGA
GCAACCTGCAGTCACACAAACACACATACACATATAGACGTCAACATCGTGTGATTGAGACGTCTGGTAAATGCAGGCACTATGAAGGTACGTACCGCGC
ACGTCTCGAAGAATCGGGATATCGTCGCGTGGCGGCAAGACATTCAGCCTCAGCAGCCGTTTCCAGTCATTTGCGTTTTTCATAACAGGCAGAGAGCGAT
TATCCTGTGCCACGATGACTAATCGATGTGCCAACACACGCCATAGATCTAATGAAATGGAATCCACAATGAGACAGAAAAAAAAATGACATGATCAGCG
TGCGCATTTCTCTATCGACCATTGACTGGCAACGTACGGAACTCGTGCAGCAGCGTGCGCAGCCACTGCGACGTGCACTCGAGCGTCAGTAGCGCGTTCA
CGTCCGCGAACTCGAGCGCGTACGCCAGTAGAACTGGCGGCAGCTCGCTCCACGGCGCAAGAGCGCTTCGGACGCGCGGTGTCGCGGTCATCTTTGAGGT
TTTCGTGGGCTCTCTTTCTGTTCCTGAACTGAGAATTGACAGTACTAGACTCCCTCGTTTGAATGACAGATAAGGGTAGATGTATATGTACTGTCTAAAT
CGGATATAAGAACATAGCGGAGTTAATGTCGATACAAACAACAAGTGAGCTTGGACCCTACCTGATTGGATGAAATTAGACGAAGATGGACTGCAAGAGT
CTGGTATAAGAACAAGATCAAGTTGCAGGAGCATCTAAAGTTTTTAAACTCAACTTTGTTGCATTCGTAGACGGCGGCTCTATCTATGCACCATGTATAC
TGCCGTCCATTATCCTATCATCAGTGCTTTTTACCTCTCGAATCTTCACGGAGCAGGATTAGCCAGCTTTTTTTTTGGTAGAAACAGCATCATCAGAGAT
CCCATCGGTTGACTTCTTGTCGAAGCAACTGCTGAAATCTCGCCGATGCCGCACGCTCGCGCGCGATCTCTTGTCGCAATCGTTTGATACGCACGTCTTC
TTTTTTCGCGCGATGCGAGAACTGCTGCTGCTGTTGTTGCAAACGATTGCTGGAACTCGATGACAACGACATGTCAATAGCAGCGACTCCAAAGCTACGC
TTCAAACTCTTCAGCAAGATCGACGGCATTTTCAGCGCTTTTCCTTCCACTTGCTTCGCCTTGTTATTCTCCACCACTGGTTGGTCGACTACAACAGCAA
TCTCGCTGAGCTCGACATTGTATTGTGGACGCCAATCTACCGGAACAAATAGACTCAACTCGTCCACACTTTCAAGGAACGCGCTGTAGATCTCTTGCAA
AAATTTCTTCCATGGCAGCATCGTCGTCGCCACCTCTGCAGTGACCGACTTGGTTCCTTCGTTGTCGGCCATCAGTGCTCCATGGATGGGAATTAACTGG
TTGTAAATGAGCTTCTTCAATTCGAAAGTCGACACTTCAGCTGACCCTCGCGGACTCGAAGCGAAAATCCGATCGATAAACGATGCAATCTTCGCAAAGT
ATCGATTGCATACATCGTGGCGCTCGAGCAACTGTTGAGTCTCTGGTTCAATTGTTGTCGATACGAGAACGGAAACCACTCTTTCAAATGCACGCCAGTT
CTGGTCGGTATTCTTCCCATATCCAGGCACTGCGAGGATATCCTGCAACTCTGTTGGCGGGTAATCGTCACCGCCAATCGCGATCTCCACACGAAGGTCG
TCATAAATGCTGCGAGTCACTTTCTGCACCTCCTTCTGCGTGCTAATACTCGACGTCGCACACCGATTGATCGCACAACTGATCCCATTTTCGAGCAGCT
CCCACACGTCCAGGTTCTTCAATTTCGGTGGCCCAACCCATCTCTCGGAAAGCGAGGCAAGTGCTCGCTGGAGCTGGTCGATCAAAGGCACGTTCTCTTG
GACATCTCCAGACACGAGCTTGACATCTACATTCACGAGTGGCGCAATCTTCGCCACTAATTGGCGGATCGATCTGTCCAAACTACTGAGCGTCTGTCTT
GATGCTGGCGAAGAATCAATGTTGTTCAAAACCAGAACAGAGACTTGACCGTGGCGTGGTATCATGGAAAGTAACACTCCCATGTATTCGAACCATCGCT
GGCGCCTTCCGCTGTCTTGGACTTCATTCAAGGCAAGCGGCAAAAGCAATGCTGACGTTCCAGAAACGGCTGCTTTGTGGTGCTCGTCCTCGAAATTGTC
CATGAAGCTCGCATTGACATAACGACAGCAAACCGCGACATCGTCCGCTTCGGAACAAAACACTTGATATGAAGTGGAAGCATCGGTAACCGAAACACCA
AGTCTGGAAGCGCACCACACACCAAATGAAGAGGTCTGGTTGTCCAAGAGATCTGCAACGACGAGCTTCCACCCGATTGGCACTGAATCAGGTTTGCGCA
CTTTCCGTAGTTGCGCACCAACGATGGAGAGCACATCCAGACACCGCCAGCTATCAGCAGTTGTTTCAACTGGATAATCAGATGCAAGTTTGATGAGCTC
GCTTGGGTTGCGCAGTCGAGTCCCGATAGTCGATGCTACGTTTTCATTTTTGAACAACCACTGAATCGTACTCTTTGGCTTGAAATGAGACACACCATTG
AGAAAACGCAACGCATCGAGTTTCACTGGCGCAGGCATCTGCTTGCTCGCCTTCACATACTTCTTCCAAATATGGAACCGCAACTTCAACATCGCCTCCT
TCTGCTTCTTAATGCGAAGTTTGCGTTTCTGCTCAACTCGTACACGAGCAAGTTCCTCTTGACGCTTCGTTGCTAATTCGGCTTCACGACGCAATCGCGC
TTGCTCCTCAGCAGCTTGCTGGCGTCGTCGCCGCTCAAGTTCCTCCGCAGCTTTTTTTCTCACTTCTTCTTCGCGCAATTCTGCTTCACGACGCCTCTTT
TCTTCGGCAAGCTTCGCCTTTAGCGCCTCCTGTCGTCGAGCTTCAGCCTCTCGTTCTCGCTTCGCTGCTTCTTTTTGTTGCTTTTCCAACTCAGCAATTT
CCCGTTGCTTCTCCAGTTGTCGCTGTTTTTCCTGTTCACGAAGCTGGTCTTCAAGCTCCTGCTGCTGTCGTAAAGCTTCAGCCTCTCGTTCGGCTTGTTC
ACGCACTTTTGCTTTGGCTTCTGCTTCGGCCTTGGCTTCGCGGTCAGCCATTTGAGTGGCCGCTGCATTCCTCTCTTGCTCAACACGTGCTTTTTCTTCT
TTTTCTCTTTGAAGTTGCGCAATGCGTTGCATTACCATTTGCTGATTCCGCTCAAGCTCTGCCTTCCGTCTTGCAATGGCTTCCAGCTCGTGCATCTTGT
TGTCTCGATCTGCGACGCCTTGATCATAGTTTTGACTTTGACTTGTTGCAAAATCACGCTGATTTGAGGCAGGAGATTGGGCCACTCCGTTTACTTCGTG
AGCGTTACCTGACGATGAATAGTCGACAAAGTACGAGTACTTATCTTCACACAGAGGTTGCGAAGGATAGAGCCTCGCTCGCTCCTTGTATTCCAAATCT
TGAATCAGATGGCTCAGCGCTGGGTACTCCTCGGGATAATACTCGGTCACACCACGACAAACATCTCGCCGCAGATAGTTCCTATTTTCACGACCATAGT
TGACGTGTGTGAGTAAGCTCGGAGCTGTTCAAATGCGCAAGAATGTTGAAACAGAACAACACACTAACATAACAAACAAAGTCGTACCCTTGCTTTTGAC
CGACATAAACTTTACTTCCGCGCACTTCGAGTGGTCGCTTGTTTTTTCGCAGTTGGATTTCTGTGCAACACGTGACGTAGTTAGCTTCGACAACATCCCA
CGCCATGTTACAGAAAATTCAGCAAGATCCATACCTGTCTCAAAGTCACCGCCAAACTGAACCATGTACGACTCCTCATCGTTTTCATCTTGCTGAATGA
TCTCTAGTCCGTGCTGAGAACACACGGAACCTGCATGGTCCATGTCGTCGAAGCAGAGCAGGTTTGTCAAATCCACGAGCGGATACGGCTGTTTGCGGAA
CGCACGGTTCATGCGCTGCAGCGCCATCGATCGGACGCTGGGAAGGTACCGGAACAATAAGCACGATTGCAGGTAGGTCGCTTGACGCAGCAGCATGAAG
AACTGGAAATAGTCACTTGTATGCCGAGCCACAAACACTTTCATCGCGAATTTCACTTGCGGACTGTCCACGATCGACTTGTGCAGCCCCTTCACGAACT
TCAGCACATCGAGACCACGACCATTGTCCAAAGTACACAGGATGAAGTACGCGCGGAATTCGGCTTCAAATGGGCTCAGATACGACGGGTCACCGAGGTT
TCGACTTTCATCGTACAGCTCGTTCAGCGACTTGAGTGTTTGACCCAGTTGCTCCATGTTTTGCTGGGCGACGAAACTTGGGACTTCAATGAGTTCATGC
TCGCTCAAAATGTGGTATCGTGCGACTCGTTCGTGCACATCCAACGCAATGGGGTGCACTCGGCCGCCCGCACCACGGTAGTTCTGCAGCACGAAATCCT
TTCGAATCATGCGGAAACGATCCCAGCAGAAGTTGTACAACTCGATGATCTCTGGTACACGCGGAGGATTCAAACGAGGATCAACCCCGGCGCGTTCTCG
GTCCATGATCTCTTGCTCAATGTAGAGCTGCGTGCGTCGCAACACGCCTGGTGGGCGCACTTCCGACGGGATATCCAACTTGTGGTCTGCAGAGCTGCGC
TGGAACCGTTTGATGATCAAATCGCGTTCTCGACCAGGTTGATCGGGGAAGCACTTTTCAAACACACTCAGCTCGTCTACTCGGATGTGGAGCTCTCGTT
CAGCTGGACTGCACATGTCAACACACGTCCCATCCAGGTTCACAGCCGAAGACAGCTCGGCTTTGTTGGAGTCGTC