Description :
From Genome Similarity Track
Location :
Scaffold_689:2307- 4122
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_689-snap-gene-0.7ATP-dependent RNA helicase DHX8

Sequence
1815 bases(100 bases per row)
ACCAGGTGCTCGTCGTGATCGGCGAGACGGGATCGGGAAAAACCACGCAGATGACGCAATACATGGCTGAAATGGGGCTCACGTCCACGGGCATCATTGG
GTGCACGCAGCCTCGTCGTGTCGCGGCATCATCGGTCGCGAAGCGTGTGGCGGAAGAATTTGGTTGTGAGCTTGGGCAGGAAGTCGGGTACTCGATGCGT
TTTGAGGACTGTACGTCGCCAGAGACCGTAATCAAGTACATGACCGAAGGTATGCTGCTGCGCGAGTATCTCGCCGACAATACACTGTCCAAGTACAGCG
CCTTGATGCTCGATGAAGCCCACGAGCGTACGATTAACACGGACGTGCTCTTCGGTCTTTTGAAAGACTTGGTGCGCAAGCGCAAGGATTTGAAGATCAT
CGTGACGTCGGCAACTTTGGATGCCGAGAAATTCTCGCGCTATTTCTTTGATTGTCCGATTTTCACGATCCCAGGACGCACGTTCCCCGTCGAGATCCTG
TACACGAAGGAACCCGAGCTAGACTACTTGGATGCGTCGTTGCTCTGCGTCATGCAGATCCACCTGTCGGAACCTGAGGGCGATATCTTACTGTTCTTAA
CCGGTCAAGAAGAGATCGATACGGCGTGCGAGGTGCTCTATCAGCGCATCAAGTCTCTTCAGGAACGAGCACTAGCGCCGGAGTTGATCATTCTTCCCGT
GTATGGTGCCTTACCATCGGAGATGCAATCGAGAATCTTCGAGCCTGCCCCCAAGGGGTCCCGGAAGTGCGTTGTGGCGACCAACATTGCTGAAGCCTCG
CTCACGATCGACGGTATCTACTACGTCGTGGATCCAGGCTTCTGCAAGCAGAACGCATTCAATTCCAAGATTGGCATGGACTCGCTCGTAGTCGTGCCGT
GCTCGCAGGCTTCGGCACGACAGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACGGGACCAGGCAAGTGCTACCGTTTGTACACTGAAAAT
GCGTACAAGAACGAAATGTTGCCGACAACCGTTCCAGAAATTCAGCGCGCTAACTTGGGCTCCGTGGTGCTGCAGTTAAAGGCGATGGGGATCAACGACC
TCATGGGCTTTGATTTCATGGATCCGCCGCCGCAGCAAGCGCTAGTGATGGCGCTTGAGAATCTGTATGGACTTGGGGCGCTAGATGATGAAGGGCTTCT
GACCCGGCTGGGGAAGAAAATGGCCGAGTTCCCTGTCGAACCGAAGAATGCCAAGGTTTTGTTGACGTCGGTCGTGCTGGGGTGTGCGGAAGAAGTACTG
ACGATCGTCGCGATGCTGTCGGTCGAGACGGTGTTTTTCCGTCCGAAGGAGAAACAGGCGCAAGCCGATCAGAAGAAAGCCAAGTTCCATCAGCCTGAAG
GCGACCATCTCACGCTCTTGGCCGTGTACGAAGCGTGGAAAAACTCCAAGTTTTCGAATCCGTGGTGCTTTGACAATTTCATTCAAGCGCGTGCGATTCG
TCGTGCGCAGGACGTCCGGAAACAACTTTTATCGATTCTCGATCGGTACAAGATGGATGTCGTGTCCTGCGGCAAGAATTTCAACAAAGTGCGGCGCGCG
ATCGTCGCGGGGTACTTTGCGAACACGGCCAAGAAGGACCCGCAGGAAGGGTACCGCACGATGGTCGAGGGCCAGCCCGTGTACATCCACCCGTCGAGTG
CTCTTTTCAACAAGAGCCCCGAGTGGGTCTTGTACCACGAGCTCGTGCTCACGACAAAGGAATACATGCGCAACATCATGACGATCGATCCAAAGTGGCT
CGTGGAGCTTGCACC