Description :
From Genome Similarity Track
Location :
Scaffold_4:230693- 233695
Transcript NameFunction/comments
Phyke_g463hypothetical protein

Sequence
3002 bases(100 bases per row)
GTACATGTAGATGACTGTAGAGTAAGGTAGGCCGCTGTTTTGTCGAGAAGCTCTCGTGAAATAAACTCCTCTACATTTAATGCAACAGGCTTAGCTAACC
GTCGATCTGCACCACAGCCGCCACCTATGCAGCGGCGCGATGCGGATCACCTAAGTGAACCATACGGtcttgacgtcgtcgtggcCGAACATCTTTTTAC
ACGTCGGGCACTTGCGGTTGCGCGACTTGAGGTTGTTCTCAATGCACTCCTTGCAGAACATGTGGAAACACTTGGAGATAATCACGTCCTTGCGTCGATC
TTGACACACTGAACAGTTCACCAACTTCTGCAAGTCACGCAGCTCGAATCGTTCCAGATCTGTAAGCTCGCCTGTAGAGGAGGCTGACTTGGCGCTCTGT
AGCTGGCGCTCATATTTCTCTGTCTTCTTGCGGTATGTATCGCATTTCTCGCATGGCCGTTGCTTCTCCTGCAACatctgttgctggcgttgcgttgact
ctgcagcagaactCGCAACAATCTTCTTGGCTACTTCAGCATCACGTAAAGCTTTGCGCTTTTCAGCATCGGAGGCCTCGCGCTCTGCGTCGATAGTCTT
CACATACTCTTTCATTTTCTCGAGTTCTAATGCTTTCGCTTGCAAGCATTCCTGACACACATTTTCACCAGAAGCATTCGTTAGTAAGGGGCATTGCATT
GCTAGCACTACGCATTCATACTTTGTAAATCCTACCTCAGATGATTCGAGGAACGCCTTCTGGTGTTTGTGCACAGTACTCAACGACGAGACCTGCAGCC
GTGCTGCAGCCAACTCTTCAAAGCAGTGGGCCTTTGCCTGTTCCTCTCTCGCGAGAAGAgtgtgcagcttcttgcatGAATTTCGTTTTTCCTCAATTTG
CTGGACAAATTTCTTTCGGCTATGCCGCATTGACTCCAAATCTTTCGCCATCGTCTCAAtctccagaagaagagcatcatTTTCTTCCCGAGATGCTTCA
CTGGAAGCTTTCATATCTTCGATCTTGGCACGAAACTTCTCTCGGTCAGAACTACACCTGTGATGCTCTTGCAGCTCTAGCTGATACTTCGCCTCCATTT
CCGATAGTCGCTTCAACGCATCGGAAAGCTTGTCAGTGGCATTTTTCCTGTAAGCACGTGATAGCATTGGCAAAACGTCGAATTAATGGGGGAAATCACA
CCGCTTAGCAATAAATCTAACAAGGCGCACATTTCTGTTTGCTTCAGTGTGTCATAAGCTTGCTGCAACTCCTGCTTTTCCTTTTCCAGCGAAGCCAACT
AGAAAAGACATCAGCTATTAGGCTCCGAACTGCAACAATGTACCCTTTCCAATACACATAGAAATGGAGTAGCCCTCACCTTATGTGTCAGCTCTTGGGT
TTGTTCATTATCTGCAGAGGCCTGAGCCCGGTCCGCTCGGCTCTGCTCTCGCTCGACCTTTGCCTTCAAACTTACGTTTTCACGCTTCGCAGATTCAAGC
TCGGCCTTTGCTTCCGTTAGCTGCACAGCATAAGCGCTCCATTGTTAACAATCTCCAGTACGCAACATACACTGGTGTTCATTGGGAATGCTTTCTCACC
TGGTCACGATAATTAGAAGCGTTGGAGAGCTTCTCTCGTAGCGACACATTCTTTAAGTTCACCTCGTCAATCTGCGACTTGGTTTTGCTCATTTCCGCTT
GGATCTTTGTAATCTTTTTCTCCCACTTTTCTGTCATGTGGTGTTCAACATCCTAATCCCCACAAAATACAAACAACATAGAACCAAAATTGATCAGTCA
ATAATTGCACAATGAGGTGAACATACCAAAAAATGCTAACCTTTGCTTTGTGCTGGATCTTGTTATACTCGTCGACGGCCTGTGCTTTTTcatcttggag
ctgcttcaattTTTCTTCGTGATCTTGAATCAATGTGCTCTCATCATTTTCCCACTGATCGACGCAAGGCAACACAAATGTTAGACCCAACTCATTCAAC
ATATGATGCTGGCTATGACCTTGTGTTTACATACCGCTGCTTCCAAAgccttcaacttgtccagcTCGCGGCGCATGGAGTCCATTTTTTGACGCTCTTG
GTATAACTTTGTACTTAAGATCGTCATGTTGTCCCGCAAAGTTGCTACGGTCTTAGCATGTTCTGCCTCCTTTTTTGTTAACTCCTCCTGGTTCACCATG
GCAACCGTATCCTTCTCGCGTGGTTTCTCGTCATCTGCAACCTTCTCGTTTTTAATATCCTCCCCATTCGCGCTGTTGCCTTCTACACCACCCTGCCGCT
TTACAAACGCGCTTAGACGATCGTAATCTCGACATGCCTGGTGGCGTTCTGCTTCCTTGAATTCTACATCATACTCGAGACGCGCGATCCACGTTTTGCA
CTGTTCACAAAGCATCACAAGTCAGATCTAACTCAGAAACGACACGAAACCTCGGTAGAATGTCTATGCCAAACGTACCGCTTGTaattgctgcttcaga
tTTAGTGTTTCCGCCACAGCTGCACGTTTCTCCTGGATGATATGTGCATACTCGATGAGTTTGGTCTTATCTTGAGAAGCACTTCCAACTACTCCAAGCA
GTTtctgcaaaagctgcttcatctcctcgctcttctgctgaagttgtccaTGTACTTCACGCTCCATTTTTGTCAAatctgcagcatcaatatACGTGTT
GCtagctgcatcttcatcggtATGCAAAGACACATCGGCATCTGGTTCTTCTGTATCTGCATCTCTTGCAACAGTGAGGAACCACTCTGGCAGATTTAAT
TTGAGCTCATCTGCTCGTACGCGGACCTGTCCGAAGTCGTTTACCGCATCTAGTGCTGCTCTCCACACCTCTTTAGACGTCTCGTCCGAGACAGCATAGG
GGTCTACAGTCTTCACTGCAGCTAATAGTTCATCCTGTAACTGGAACCATTGCCTTCTTAAGCAGCGGAAAGAAGCTCCAGCCATCCCTTGAGAGCGGAA
CA