Description :
From Genome Similarity Track
Location :
contig_55:230685- 232228
Transcript NameFunction/comments
g10968.t1hypothetical protein

Sequence
1543 bases(100 bases per row)
GTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAG
CACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCAGACCCA
AGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGG
ACTGGTACATCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGCTAAGAAAATGGGTATCACCACCACGGCCTCGATC
AGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTACCTTCGTTAAGCAGTGCGTCCTGAAGC
CCTCGGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAA
AGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACG
TCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGATACTGAAGAGGATCATACTCCGGGCGCGTCTCG
AACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGG
TTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAA
ACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGT
TGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATC
CCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGA
GCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGT
GCAGACCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAGCAGCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGG
TGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTG