Description :
From Genome Similarity Track
Location :
contig_39:230668- 231670
Transcript NameFunction/comments
g8559.t1RAW30740.1 hypothetical protein PC110_g12906 [Phytophthora cactorum

Sequence
1002 bases(100 bases per row)
CGGAACAGCAGGCTACTGTGAGGTCGAAGATGAGGATTCCCACGAAAAGTTTCGTGTCATGAAGCGGACGTGTACGAGAGGCAAGCAGGCGGCCATTTTC
CAGTGCTCCGATGCTCCGGGATTCGCGAATTTCCACGTTGAAGCTGAATATGCCGTTGACAAAGTCCTCGCTCCGGAGTTCGCTCTTCCCAACGTGAATA
GCAGTCAGGGCTACCCGCGACAAGGAATTGCCATGGTGGTGTATCCCCAGCTAGTGGCTAGTGCGTATGCCACCATTCGAGCACTTCGAGAGGTCTTGAA
CTGCCAGCTACCGATTGAAATTTGGTTCCGTCCAGATGAAATGCGCAAATCTCCTGAAGGACTCGACCCACTCAAGAGTTTGACCAGTGACGGTATTGTG
GGAAACTTGACTTTCGAAAAGATTGACGACCCTCGAGCAGTGCGGTTCAACGCCAAAATCTACGCTATCTACCACAGCAAATTCGATCAAGTGCTGTTCC
TGGACGCAGACAATGTACCCGTAAGAGATCCAAGCTACCTTTTCGAGACGCCCGAGTTCGTAGAGACCGGTGCAGTGTTTTGGCCTGACTACTGGCACCC
GGGCAACACGATCTTTTTCGTCAACGCGAAATCGCTGGTTTGGCAGCTGCTCGGTACAGACTTTGTGGACATGTTCGAGCAAGAATCCGGTCAAGTTCTT
GTAGACCGACAGCGGCACGCGGCACCGCTCGAACTCGTAAGATTTTACGCTTATCACCGACCGAACTACTTCAATCGGCTAAAGCTCGCGTGGGGCGACA
AAGATCTTTTTCGCTTTGCGTGGCTAAAGCTTGGAGCTCCCTTCCACATGATCGAGGCACCACCTGCGGTAGCCGGCAAGATGTTTGGCAAGTCGTTCTG
CGGCATGACGATGGTACAGCACGACACCACAGGAGAAGTTCTCTTCCTGCACCGAAATCAACAGAAATTGTCTGGGAAGCCTAGTACTGACCAAGTCGAT
GG