Description :
From Genome Similarity Track
Location :
Scaffold_44:23060- 24518
Transcript NameFunction/comments
Phyra_79863ankyrin-like protein

Sequence
1458 bases(100 bases per row)
GACGCTGCTCGAGTACGCGAAGGAGCGTCTTGGCACGGACTTTGCGGATGAAATGTACAGCGATGCTAGGTTGGTATTCAAGCTCTTCGGTCGCTCCAAG
AAGAACCCGATGCACGTGGCTGCCTATCTTGGAAACGTTCAAGCAATGCAGCTGCTGTTGGACGCCGGATTCCGGGTGGACAGTTATGACAAGGTATCGC
GAGTGCGTTTTACGACTGGTGACCTCTTCTGGACGTTTGCACAAATATTCGTGTCCAAGCCTCTGTCATCGGAAGACGAGATGGCCGCGTCCATCTTTCG
AACGACACTAGTAACGCCGATGCACTGCGCAGTGAGCACAGGCCAAATCCAGGTTGTGCAGTGGCTTGTCGAGCACGGCGCCAACGTAAATCTCAAGTCT
AAGGCGTCGTACTGGTCGGACCGGATGCCACCGCTTTTTGTGGCTGACAACCCCGATATCGTCACGCTGCTTCTCGAAGCCGGTGCTAACCACCTTGAGG
TGCCTGACCCAGGTCATATGAACACTCTGACCGTGCTGCAGATGGCTTACATGCGCGGCAACTTCCCTGTGGCGCACGAACTGGAAGAGTGGGGTGCAGA
TGTGGCGCTCACTCCTCTGCACGAAGCTGCAGCTAAGGACTGCACGACAACCATCAGGAAACTACTGAAGACTGGTGCAGATCCGAACTGCGTGGGTGAG
TACGGTTATACGGGCATGCACCGCCGCACGCCATTACACTGGGCAGCCATCAATGGAGCTATCCAAGCAGTCGAGATGCTGCTTGAAGCTGGCTCTGATC
CGAACTTCCAAGACATTTTTGGGCGGTCCCCTTTGCACTGGGCAGCACGCGTGAACAAGCCAGCCGTGGTTCGCTTGCTTTTGGACAAAGGAGGCGACGT
GAACTTGCGCGACTATCGGGACCACACTCCTTTGCTCTGTGCTGCGTCCTCCAAAAACGTTAGTGTCGACCTTTTCGATTGTCTCGTCCAGTTTGGCGCA
GATATTGACGACCGTCTTCCTAACGGTGACACCGCACTGCATATTGCAATGAAATGCGAGCAGAAGGGCACGGCATTAGCACTCCTGGACGCTGGTGCAG
ATGTGATGGAGACTAACCGCGATGGCTACCGTCCGGTGGACTGCACTACCTCGACGCAGTTGCAGTTCGAGATCAAGCAGGCCGCGGGTGATCGTGATGT
CATGATCAGTTATACGCATTCACACAGCGAGTTCGCGCTGAAGATTCGGGACAGCCTCGAGCGTGCAAACATTACGTCGTGGCTTGACCTCATGGACCCC
ACCGGCATTGGCGGTGGCTCCGTGTGGCGCGAAGAGATCGCTCGCGGCATCAAGAATGCCGAGGTGATCATTTGCCTGTACACGGAGGACTACCCCGTCT
CCGAGTGGTGTCTCAAGGAGCTGGCACTAGCCAAACAGCTCGGCAAGCCGATCATCGC