Description :
From Genome Similarity Track
Location :
Scaffold_2097:2306- 3314
Sequence
1008 bases(100 bases per row)
CTGCACTTACGCGAATGAGATGTACCTCCGCAAGGTCGCTCGAGACCACGCTACACCACCTGGACGGGGGCAGCTCGACGCTAACATCTATTATTGCAAT
TTTACGCTCAGATCACGACAACGCCATCGACATCTTCCGCACTGGCCTAGGAACATCTATTCGGTCGTCCTAACACCGTCGGCTCTGGTTTGCTGACTCG
TTCTGGCAACAATGGCTCTGGCCCATTCGCGGACGTTTGGCTGTGTCCGTTGGCGCTTCAGAATCCCCAAGTTAACATTCCTTCGATAGTGCGTAAACAG
CCAATCGAGCTACAGAACATCACCGCGCATGCCAGCGAAAAACGCTGCGCCATTGTTACAGCCCTCTCTACGGTTAACGTGGAGAAATTCCGCGATGTGG
CAATTGCCACGGAACAGAGCATCATCCATCGCATCTGTTGAGCATCCTTCACTGCGATTCTCGTGGAGCCATTTCACTATCGACAGCTTGCCATACCTTG
CAGCAGCGTCCATCGCTTTCTTCGAGCAGCCTTCAGTGCGATGCTGATGAAGCCACTTGACGACATCCAGGTGACCAGCTTCAGCGGCGCTGTCCATGGC
GTTCGACGTGCAGCCTTCTGCCCGGTTCGTGTGCAAGAACCTGACAATTTTGAGATGACCTTGTCCAGCTGCGACGTCCATCGCATCAGCTAAGCAGCCT
TTAGTTCGATTAAAGTGCAGCCATTCGACCATCTCCACGTATCCGGACTTCGCCGCATTGTCCATGGCAGCAACGGTGCACCCTTCGTCTCTGTTTTCGT
GCAACCATCGGACGATATCGAGATGCCCTTTTGCCGCGGCGCCATCCATCGCTGCCGAAGTATAGCCTTCACTGCGATGCTCATGGAGGAATTTCACGAC
GTCCAGGTGACCTTGGCTCGCTGCGTTATCCATCGCACACACCGTGCACGCTTCGGAGCGGTCCACTCGAAGCTGGTGCTCACTCTCCAAGCTGTCTTCG
AGCTCAAT