Description :
From Genome Similarity Track
Location :
contig_9:230595- 235190
Transcript NameFunction/comments
g2243.t1hypothetical protein
g2244.t1hypothetical protein

Sequence
4595 bases(100 bases per row)
TCTTGGTAGTGCTTGTCCGAGCGGAGAAAGCTTCGAACAGACCAGAATGGCTCATTTCGTGCTCCAGGTCGATTGTACTGTTCCAGATGCGGTTCAATAG
CTTCAGAGAGCCGAACGTGCAGGCTTTATGCAGTGGAAGCTCCACCGATGTGTCCAGGAAGGAAGAAACCTTTTCAGTGATGTGGAACAACGATGACAAC
TCGCGCTTGGAACTGGTGAGAATCGACGCAGCTACCAGCGGAGTAGGAGGTGGAGGGGTGGGGAGATGCCATCGTTGCAATGGCAAATGCTGAATGACCA
CAGACAACCTGCAAACTCCACACCACCTGTGTCTTGGGTACAAATGATACACCCCAGTTGTGCGCAGGTCACCACGGTTTTGCCAGAGCAAATGACGAGC
ACGACCCGTGAGGTTTTTCCTCGAGCAATAAAACCTTACGAACAGTGTTCGCGAGGTTTTTCAATTCGACCTCACTATCACTTTTTTGGGGGAGCACGAG
AAGTGTCAGGTGCATTTGCTCGTTCTCCGGCGCTTCAATTGGGTGTAAAAGACCATTTTTAATTGGCCGTTATTCAGCGACGATCATCTGCAGGCGTAAG
TAAAATATAATCCCGCTTTCCAGCAAGTCCGTCCGCCCCAGCAAGTCCCCGCTCCCGACGTCATGGTACTGACCCGGGCCCAGGCGAAAGCAGAAGCGGA
AGCTCAAGCTGCGCGAGGCAACGAAGACGATCACGATGAAGACACGTACGACCCCCAAGCGCCGACGCCGAGTACCCTGACGGCTGACGCGTACGAGACC
GAAGACATGACCGATGGGCCAAGTCGCGACACCGCGTCGGCGTTAGTGGTGGCGGAGAAATCAGGGCGAACATTTTCCCTGGTGTTGAAGAACACCTCGA
GAAACTGGCGGGGTCCTTTCTCGTCCAAGCGCGATATCTTGTTGAGGGGCACGCGATGCTGCAGTCCCAGCAAGAAGGGCAGAGTAATGCTCAGAGCGCC
GCTCTAATGGCCGTTCAGGACTCGACCGAAACCTGCATCAAGGAGCTAACGGATCGGCAGCTTGCAATAGCTGGTCAGTTCCAGGAAGAGTTCAATCGGC
CATCTGTGAACAGTTATGGCGATGCAGGCGCAAGCTGGAGAGCAGATCAAAACGTCTGTGACGGAGAAGCTCTTCAATGCGCTGCGTGATGCAGTGTGAG
TCCCAGGAGCTAATAACCTCCCAAACGAATGGAGTCAGTCGACTGGGACTCAGCTGGCCGCCAAAATTGATGACATCTTCCAGATACTTACATCTCGGAT
CCAGCAGCTCGTCGAGGAGCAAACGGCGGTACGGCAGCACGCGAGCACCGCTTCCGAAAATCGAGCCCGTTTTTGAGCTTGTGGAGAAGTCCATGACAGG
CATAAACGCCCGCGTGGAACAATCGCTAGAAAGGGGTTTACAAGTCGCGCGCGATGAACTAAGGCAAGAAGTGTTGTAAGCGCGTGTGGCCTCGACTGGA
GAGTCAGCACTCGACGCGGTTAAGCATTTAGTGGCGACTGAGGCAATAAAATCAGAGCGACGTATCGAGGCACAAGTGCAGAGAGGACTGACGTCCTTCC
AGACTGATATACAACTTCAAGTTCAACGCCAAGCGGACGCAACTTCCATTCTGCGGGATCAGTTCCAGCAGCACTGCGATTGTGCTAAATTAAAGCAAGG
GTCAGCAGGTGAGGGACTTCGCAGTGACGACGCAAAGGAACTTGTGCGAAAGGAGGTGGACGAGCATGACTACTTTGCAGCGCCAATTCCATGCCGTGGA
CTCCAGGCCGTGGAACGCGAGCGACAAGCTGAATTGCAAGCCAATGAAACGGAATTGCGTCAATTGCAGGCCGTGGAGCACGCACGTGAAGCCGAATTGC
AAGCGAAAGAGGCTGAAGTAAATCATGGTGTGACAGAGGTGGTTGGAGAGCGTCTTCGAGATCCTGCAGCCGATATCTCGGCAGAGATCAAGCAATCACT
GGAGAGAAGCGTGAAGACGATAATTGAACTCATTAGTGTTGCTGTCGATCGCTACGCGCAGACAAAGAGGAGATCAAGACAGAGATTGAAAATCGTGGCA
GCGTTAGTGAAGATGATGGAGATGAAAATTACGATGAATTGTCGGAAGAAGATCACTACGCACAGCAGCGAATGCGGGACGCCCTCATTAGGGCTTAAGC
TGCAAGCACATCACCGATGCCTTCACTCCGCCCTCATTAGGGCTCAAGTCGCAAGCACACCACCGATACCTTCACTGTTGTGCATGTGGAAGGACCACTG
CTTCAAGATGGCGAGCGTTTTAAGAACAAATACAATCACCATGGATTTCCACCAGCAGTGCAAGGTCGTGCTACCATCTCACCGTGTTTGTGGCGGTCGC
AGAGGTGGTGGTCGCAGTGGGAGAGACTGCTGATGTCCTGAAGACCGCTGGAGAACCTCACCGTGGAAATGATACCGAGTCTGCGGAGGTGGCGAGCTGG
ATGGAGGTCGTCGTCAGACCGTCGTCTAAGAAAACGTCCCTGAACTCAAGCAGGAAGGCTGTTATCGCGGTGCCAGCGGTGATAAACTCACCGTGAGAAA
TATACCATAGTTGCCGAGGTGGTTGTGTCATGCGAGACGAATACGAGGATAAGACGAAATAAACGTAAAGCATATGATCAAACAAAAAACATATATTAAA
CACAGTGAACGTGAAACTACGAGTTCGTGAAACTACGAGTTCTCATTATACTCCTCGTTCAAGCTGAAACTCGTGCTCGACATGAAGCCAGCCAAGATAT
CATCAGAGAAATCATCCTCCATGTCCCAATCCAGATCCAGAGGGTAAATGAAGCAGGAGGGCGTGTGCTCGCGGTGTTTCCCCCTTTTGATCGCCTCACA
CTGCAGTAGATCCACAAATTCGTCGTTGCGGTTCAGGAACGTGGCCATGTCGATGTTGTGTTGCGACAAATTGGTACGTTGTGACGTAACCATACTTCCG
CTAACGCTGAAGTCCCGCTCAATCTGGCATGATGATGCTGGGATGGCAAAGAGCACTTTCACTGCACGCGGTAGGAAGATGTAGTATTTGCGGTGCTCAA
CTCGCCGCCAGAATGACAGAACCGATTCAGGTGCACCTGACTCCGACCGTTCCACCTCAATTGGGTCGTATTTCCAGCGATCCAGCTCTTCGTCCACGCG
TCGCTGCATTTGATTCACAGTGACGGCCGCTGATCTGCGCGGGGAGGGGCAAACATCGCCTCGAGCTCACTATAAAACGGGGTGGGACTTGGAGGAGGTG
GCTCGACTGCATCACTTGGATCCGCTACATCGTTCAGCAAGGTGTGTAGCCGATCGCGAATATGCTGATGCACTTTGTCCCTCTTATCGCAGGCCTCACG
TATTCCAAACCCTTGCTGTTTGCAGACCAGCAGGATGACGGCATTTAGGTTCAATCTCGGGCTTTTGAAAATGGGATGCAGTCTCTGCTGCATCTCAAAT
ACATACGAAGTTTTTGCCATTTGGTGTTCGTAGTAGCGGCTGAAGAAGCGTTCATCAAACGCATCACGGAGTAGTAGTCGGGTAGACTTCGCAAGTGGTG
TGAGCTCGTTCGGTTCAATCCAACGAGGGTTCTTGTCGGTGCTGAGGTAATGTCGAACAGGTTTTTCGTTGTTTAGGTCAGTCAATCGAAGCTTGTATAG
CATCATCAGCACGTCCACTTGATTAGGTGCCTCAGCTTGACATGCCCGTTTAAGCTCTGCTACAGGACCCAGGACAGACAGCACATGGCTTAAGTCCTTT
TCTCGACCGGCAAGCGGAAACACAGGTGGGCGAGTCTTATCTCGCACTGCCTTCCGCGCGCGCTCTGCAAACCATTCTTCAAGCGCCGGCCACTTTTCCA
GAACTCGCCGGATAGCGTTGGTGATACTCAGAAATCGGGCGGAGGAATAGTTCAGCAAGCGCGTCGTGGAGGTCTCGGTCCTCGAGTTGCATAGTGCTTC
GAAGAGATCACCCGTTACTTCGACCGTGCGTACTTGGTAGATGGTTGTAGTTAGCTGCGTAATTAATTCAGTCATCTCTGGGTTCTCCTGTTTTTTCTTG
TCGTTCATACACACGCAGAGCGAGTTGCGGCATGAGCCATATGTGCCATGCACCACTCCCATCGTAGCTGTAGTTCATCCGTCAGTAGACACCTCACATC
GGAGCCCTTGTCGCTCGTGGCACCGTAAAATTCGAAGTAGTCAATCGAAAGTCCTCCAAAGCGCGCTTCATCCATAACAGAAACGGCCTTCTGATACCTT
TGTCACGATCACCTAAACTTGCGCGTGCCCAGCAGCAAGGACCTGCCAATTCCTGTCAATTAGGTAGACACGTAGGCCAAGGTACTTCTTCGACGTCGTT
TTGCAAGTCCAAAAGTCTGCCATCATCGTGAAGTTCGGGTACACCTCTTTGTTGCTCTAAAAAAACTCGGTGATCTCCTTCCTCGTTTCGATGATAGTTT
CACCGATTCGCTCCGCAGTTATGATGACCTTTCATCTCCTCCCTTCGTGGGCCTCCAGCAACTTGGACTCCTCGTCACATATAGCGGCTGGTTGA