Description :
From Genome Similarity Track
Location :
Scaffold_15:23056- 56411
Transcript NameFunction/comments
Phyta_totarag944ABC transporter ABCF family
Phyta_totarag945hypothetical protein PHYSODRAFT_493289
Phyta_totarag946hypothetical protein PHYSODRAFT_298656
Phyta_totarag947DEAD/DEAH box RNA helicase, putative
Phyta_totarag948hypothetical protein PHYSODRAFT_313194
Phyta_totarag949hypothetical protein PHYSODRAFT_465114
Phyta_totarag950hypothetical protein PHYSODRAFT_313196
Phyta_totarag951hypothetical protein PHYSODRAFT_354318
Phyta_totarag952hypothetical protein
Phyta_totarag953hypothetical protein PHYSODRAFT_497615
Phyta_totarag954hypothetical protein PHYSODRAFT_491946
Phyta_totarag955hypothetical protein
Phyta_totarag956hypothetical protein PHYSODRAFT_345503

Sequence
33355 bases(100 bases per row)
GGAGAGCTGTCCTGGCTGCGCTGATGGCTTTGATCTTCACGGCTGCAGCTCATTTCAAGCGTTTTTATGTGAGCTTAGACGGTGTAGTCCTGCTCGAGGT
GATGTTGTTCACGATGTACGATGATGGATAGTGGCGCCCTCGTGGATGCTCCATGTTGTCCGCTACCGAAAATAGACGCTTATGACGTAACGGTGACCAG
CCAAAAAAATCTTCACAAGATTTCACGAAGAGTCATATCACGGAAGTTTCCTCACCGATGCAATGGTCCCTAGTGTTGCTATTCAGCCTTCTCCTTGCAA
GCTTGCCGTGTTTGGAGTGTGCTCGCGCAAAGACGATCAATTATGATGCACTGGAGAGAGCGTGGGAATCGGGGGAtgaggagcaggagctacGCACAGA
GGGAGACGAACATTATCGACAGCTTGCAGACAAGTGAGTGCATCATACAGAACCGAAGCGACGATACCGGCAAAATACTTACTCCCTAAGTTACTATCTC
TTAGGAGCGAGGAGGCGAAGGCGCTTGGACCTCAGATGATATTCGTGACGCTGCACAACAAACACAGCCAACATGGCGTTGCATCACGATGGAAAGAGGT
GAGGAGTTAAAGCACTAGCGACGTTCATGTATCCACCCACTTACATGTCTGCCTTGGTGGTGTCTTGGGTTGCTGTTCCAGATGCTGTGGAATGGTGGGG
TCGAGGTGAACATTTACGAAGTCGCCGACTCGAAGTTGCTCGTTGGACTGCAAAAGGGGATCTTCGTCAACGATGTCATGAGGTTTCTCAACGAGCAGCG
TGATGTGAAAGGGTACGAGTGGAATGGCAAAGCGTATTCAAACCATAGCTACCGCCACCACAAACATCAGCAGAAGGTAGCTATGAAGCCCCGACGAAAG
AAAGCGAAGGAGGAAGGTGCTAAAAGCTCGAAGCCGGTCCAAGACTTGCACGCCAACAGAAAGCACCCTCATCAAAAACATACTCAAACTGAAACTACAA
GCTCCAAGACGACGGGAAGACGTGTTTCGAACGATGAACTGTAAATTATCCATGAGCGAACACATTGAAAGCAAATGTTAATCTGAGCAATTCGCTGGGG
TCAATCCACGCGCCACGCTCTGGTCCTCGTCACTATAGTTGGATCGGCTCAGTTACTCGTACGCTCACTCCGAATGGCTTCCAATAGTGGGCCCAGcatc
ttgttcttcttcgcatTCTCCATCACGACATTCACTCTCGGGTGGGAATCAGCGTCACGAACAGTACTGATCGCATCGAGCGCACGCAACGCGCTGCGAA
TGAGATCCTTGACGCGCTCGACCTCAGGGCCAACTTGGTCCTCTTTCACCTTCTTGGTGATTGTCTTCTCAAGCGGCTCCACCAACGAATCCAGTGCACC
AACAATACTGCCAGGCTGAACATAGCAGATCTTGATCAAGATCTGGTGACTGAGCATCTGGATATCGTCCTGGTCTCCAAGGCCTCGCTTCAGTTGGTCG
AAGAACAGAGTgatgtcgagctgctgcggcaacaCCTGGATTAAAGTGTCCACACACGAATATGCAGCCTTACGAAGAGGAAGGCCATCATCCACTTTGT
GCTTGAACGGACCGAGgtccaccacgcgctccagCTTAATTTCAGTCGCTTTCAGGAGCACAGGGAAAATCCGTTCGCGAACGTAGGGCACCAGATAgtg
cgcgtggtggtgaGCAGCCGTAttgagcaccagcaatgCGGCACGACGCACATGcaggtcttcgtcttcaagtgCAGCTAAGAAGGGTTCGATGTGAGCG
AAGATCGCATTGACTGCTGGCTCCTGGGCCGTTGTCGTCATCGCGTACTTGAGACTAGTCACGGCTGTCCAACGCGACCATACGTCTGAAGACCCGCACA
GTTCTGTCACAATTGGCATGATCTTCGCACTGTCTGTCACAGCGAGCTTTCCCATGCATTCGCCAACCATGTTTCGAACCCCTTCCTCCTGACGAGCACT
CATTTTCTGTAGGACCGGAAGAACACGGTCCACGTACATCGCAAAACCGTGGTGGGGTTTTGCTGCGTGATCCGATATGACTTCGCGAAGCGATGTCAGC
AGCAGGTAAGAGTTCTCTCCAAGCTCCAACTTTACCATGATAGTGTCCAGGTACTCTTCCATGTTGCCGACGCAAATGCTACCAAGCGAGTACGCAGCTG
CGGCCTTCACCTCTTCAGCCGCATCATTGAAGCATTTCAGAATAATCTCCTTCACGTCAGTATAGCCAGCGAGTTTGATCTTGCGGCCGAACTCTCCCAA
GCAGTAGAGCGCCAAGACTTTGTTCTTTTCGGACTCTGTTTGTGTGATGTCACCAACAAACTTTGCGAAAGCTAGCTTGCGATTTTGTTCCGTCGTAGCC
ACACATGTGCCAGCAACACATCTAGCAATGTTCAGCACAGAGTGCTTCGATTCTTCAGAAGGTGTAGCCATCAGCGCCTTGAATAGCTCCATAAAGCTGC
TACCTGGTGAATTCAGCTGCGTCAACTGCGCGAAAAGGCCTTTCAGAGCATCTAAAGTGGGGCCCTGAAGCATAGAACTGTGGCACAGTTCCAGTGCCTT
CACTTGAGCGTTCTGCAACAAAGCGTCCGTCGACGCAACATGCGCGCACACGCGGAGAGAGTTTGACACCAATGTGATGCTCATGCGGCACAGCTGGAGG
TCCAcgtcgacaagaagaagcgaagcTTCCAGCACAACCTCACAGTGTAGCGTTTCCGGCATATTTGCACCCTTGTGAACAATCAGGTCATTCAGGGTGG
CCAGTGTCGCTTGTTTCAATGTGCGGGACTGCTGACGAAGTAGCTGGGCTAGAGACTGGATGCAATCCACGAGAATTGGAGACATATCCAAGTTGAGCTT
CGAACGAGCAATGACTCCAATGGCCTTAATACTTTGAATTCGCGTGATTTCGTTGTTCAGACGCTCCATTAGCAGTGGGTAGATTTCACCCACACGCGGA
CCAAGCTCGTCACCTATCgtcacagcaacaacacccCCGTTATTTCGCCAAACCAACATCAGTACTCTATCAGCAACATTCTACGCACccagaacagcaa
caattTCTCCGATACTGCTGATTGCAGCCTCCTTAATTTCTTGGTCGATGTCATGAACCTTCAAACTAGGCAGCACCGCATCGAAGAAAGGTACAGCATA
CGGTTTGTACGTCAAATCTCCATCGTCGGAGCGAATAATGCGGACAAGAGATTCAATCAGTCCAAGCGCTTTTGCCACCGTTTTGTACCAATCTCCCTGA
GCAcactgcactgcaacttTAACGATCGAATCGATGTGCGGTCGGAATGGCTCCACTATGTGGGTATCCACAAGCAGCCGGAGAAACAGAAGTGCGTCCA
ACTTCAAGTCTGAGTGCTTGTCCTCCACTGCATTGAGAATGTTCGGCATCAAACGGCCAATGTAGTCTCCCAATTTTCCATGCTCCACCATCGCGAGCTC
ACTCAGCATCGCGACCACAGCACAGCGCGACGGAACTGAAGCCTTCGTTCCGAACTGCTTGTTGGCTCCAACAACGATAGCGTTCAGGCGCTGCTCCAAC
TGGGTAATGCACGCATTCGATGTAGGTGGGTGGTGGAAGGAACTGCTTCCGTTCGAGCTCGGGAGAGTCTTGCAAGTAGCACGAAGAAGGTCTGCAAATA
CCCCAAATACGTCGATCCGAACGTTTTCTTCTCGCTCTTTAAAGCGCGAAATTAAAGGCTGGGCACAGTGAATGTACAGCTGCTCCAAAAGCTCCGGCCT
CGTCGTGATGATTGCAGTTAAAACGCGAAGGCTAGCACGACGAACCTTCCAGCTGGtatcgtcgtcatcactgtagtcgccttcctcgtcgctgtattct
tcctcttcttcttccatatcttcatcttcgtcagccGAGTCAACGTAATTGTAGTTGGGATCATATGAAATAAAATGCATCACAAGCTTTAGAATAGCCT
CCACGTGAGGCGTGATTTCGTTGTGGCATCGAATCATGAACGCCTCAAACGCCTGGAAACAGTTTCCGCGAAGCTCATCCGAGTCTTCGTTCTGCAGCGA
TTCGTCCTCAGGGTCTCCGCAGAACTGCACCAAAATGCGGATCACCGCGTCCAAGTGCTGTCCAAGACGGTGACCTGCAGTGCGCGAGAGCATCCCAATA
GTCTGGATCAGCGTGCGCACGTTCGCTGAGTCCGTTGATCCCTGGATGCCCTTGATCAGATGCTCCACCAAGCGGCTCACCAGCACATCAGACGCCATAA
CACCAAGCGACCCCACGCAAGCCGTAGCACGCTTGCGCACAAGCGGCGAGTCGTCCGTGAGCTGCAccatcagcagctccatgatCGTCGCGTGTTCCGT
GGCGACGTCGTAGCCGAAGCGGCGCAGCAGATCCGTGAGGATGTCGAGCGTCTCAGCCTTCACAGCTGCATCCTTATCCTTGCCCAGACCCGTCAGTAGC
CGCGTGCAGATGCCAGTCGCGATGGACGCCCCCGTGGACTGCGACACGTCCGCCACGATCGTCTTGAGTCCGATCGAGTAGATGTCCCGGAGCTCCGGCT
TGCCGTTAAGAATAAGGTCACACAGCTTGGCGCAAATGTCCGCCACCTGGGCCACGTGCACTTTAGTGACCAGGATGCCCAGACACTTGACGGCGATGGA
CTGCACGTCGTTCGACTTGtcatccagctgcttcagcaccgCCGCACACACTCTATAGCGCAGCAGACACGAAGGTAGGTATTTCTCTCAAATAGAAGAG
CTAGTAGCTGCACGTACTTTGGCTCGAGATACGTCCCCAGGTCGACGTCTTTGTTGAGCTCGACGCATAGATCGGACGTCGCCATGTAGCGCTCATCCTT
GTCAAAGTCCGTGGTCTGCGTACAGCGAGAAATAGATAGAAAGGGAGAGATATAGACGTCAGCACATGGCTCTCCTCGATGTAGGCGAGACGGTGcgcac
cttgtccagcagtTGTGCGATCTTGTCCTCGTTTGCGCGCATCTTTCCCTTCTGCTCTCCGCTTCCGCGCGCGCACTCCAAAGTGAAAGTGAGAGGATCT
CTATCGAGTTATGTGCACCACACAaatgaccatcactccgaGACCGTTACTTCAACAACGCGGCGGTACAGTCCGCAAATTGGAGGCTGCAAGCGACGCC
ATGAGTACGAGGAGCTCCCACTGCAGGTCGATAGGCTGTGTACTGACATACAGCGCtgtgtgtgcgtgtgtgtgtgtgtgtgtgtgttcAGGTGAAGGCG
GTGGCCCCGTGGCGTCTGACCAGCTCACGTCCCTCATTTCGGACGAGGTGGAGCGTCAACTGCGAGAGCGAGGCTCCGTTCTCGAAGCCATGAGGGAGCA
GATGGCCAAAGTGCTGGCCGAGTTCGAAGAGATGGCAGCTAACATTAGCTCCAAGCGATCCTGGTCCAACAGCGTCtccaagacgacgaagccttTCGTG
TCACCCAAGAAATCGCCCTTCAACATCCACCCCATCATCACGCCGTTGGATATCGTCCCACCAGCCGCGTCTTCTCCACCCAAACTGCCAAAGTAGTTAA
ACCGTTAGTGTTGTGTGGCTAGTGCGGAGATCATGGGCATCTCACTTGTTTCTGAACTCTCTGGAGCAGGATTGGCGGCGGTCTCAAAAGCACCCACCAG
TTCAAGAACAGCGCTAGCGGAGGCGCTCTCCCACCGGGCAATACAGGCACTCGCAGCCCCGATGGCAAGATTACTTTTGGTACGGCTGTTGTTTGCATTG
AATGTTTGGGTGCAATGTGTTATTCTAACTAATTACCTGGACGCCGGTCAGACAAAATACTTCCGCGAGTTGCTAACATGGAAAAGCGCACTGACGGATC
ACAGATGATGCTGTCgcagcagaggcagcacATGTACGAACGAGCCTTGGTCCGATATCCACAGTGTCGAAGCAATATATTCGCTCCGAGTGTATACGAC
CGTGAAGAATCGCTCAGCTTGAACTCGAGTACTGTTCTTCAGGCACCCCGAGCGTCTCTCGAGTTGGACTTTGTCTATGGATGTCGTAGCGGGGCCACCA
CATCGCTGTCCAGTAGCCATCCTGCAACGCCCAACGCAAGTACTAACAACAGCGTTTTCTATTTGTCAACGGGCGAGGTCATGTGGTTTACtgcgatgct
ggtggtgttgTACAAAAGAGAAACCAACACGCAGAGATATTTCAGGGAACACACGAATGAAGTCACGAGCGTGGCTGTTCATCCGAACCAGCGCATTGTA
GCATCAGGACAAGCGGGGCGTTTAGCATTTCTTCTGGTATGGAATTCGAACGACGTACCACTCGGTAAACGGTTTGCGTGCCTAAAGGGCCATCAAGTTG
CTGTGCGTTCTATCAGCTTTTCTCACGACGGCAAATTGATTGCTTCCTTGGGTGGCGACATGTACAACACTATTTGCATCCACGACTGGAAAGCACAGGA
ACTGCTGGTTAGCGCTCGAGGTCACACGTTTCGAGTCCACGCGGTTGTATTCAATCCGTTTCAAGCGTATGGCAGACCAGAATCCCATCGATCAAAGAAA
CCTGGACAAGCCCtacacgacgacgatgctTGCTACACTTTGGTCAGCTGCGGTGTTCGGCATATCCGCTTTTGGACACTCACAAAAGCGGACTACGTGC
CCCCGCCATCAAAGGAGAACGCTGATAGTGCTTTTTCTCGCTCCACGTTTGGTGGGCCTCCAAGACTGCTTCCTCCGACTCCGACCGAGAAAGTGTGGAA
ACTGGAGGGCAATGTTCCATCATTTCATGGGCGTTTTGAAGTCCAAGACTTTACGAGTTTGACATGTGTGAACGATTCTCCACctctctacatgtatgat
gAACACTCAAAGGAGTTGGTGGCGACGAATGCCACAGATCATTCGCTCGGCCGGATTATAGCTGGCACGGCTAAAGGAGATTTGTGTCTGTTCGTGCAGC
CAAGAGCGAGTCCTAATATTGATATCATTTCCGAGAGAGACTTACAAAAAGAGCCTGCGAAGTGGTGGGAGATTCCAGATGAATACACTGATGCCGAAAT
CAACGAACTCGTAATGGAGAAAATCGCATACGAGCCGACTGGAAGACTCGTTGATGTCGTACCACACGACCAAGAAACTGGCAATCGTTTTAAGTTGCCT
AGACAAGCTCAAACGGAGATGGAAGGACTGTCAAAGCAAATGACATTGCGGCCTAACTCAAATGCCTTGTATTCCCGTTTGGGTGAACTAAAATATAGTG
GACCGCTGGCTCATCAGGGAGCAGCTTACCAAGTGACCTACTCCAAGAAGCTCAATCTGATCATGTCGTGTGGAAACGACGGAAAATTGCTGTTGTGGAC
GTGCCAAATGAGCAAGCCCATGCGAATTCCTGGAGTTAATACACAAGGAGTATTCACGCCACTGACAGGGACGTTTACGGAAGGATCACACTCCATTCTT
CCTTGCGACGACCCAGCTAAGGTGTTTCAATTGCCGAGTGTATTACCAACTGAATTAAGCGCgagcggtgctgcagctacaCCCAAGCCCACGAGTATCG
TGTGGAAAGACGACGGCAATTTCGTACTTGTTGCCACTAGCAACAGTTGCATTTGGGAACTTAATCTCGCATCCGGTGAATGGCAATTGCTGTTCGAAGC
TCGCAGTGGTGCCGTGGCAGCCTGCGCCGCACACCCCACAATAGAAGAGGTAGTTACGGTGTCTCAAGATGGGTACCTTAGCTTCTGGGATCTTGAACAG
CACGTGTGTAGTCGCCGTCTCTACCTTGGAAGTTTTCTTACCTCTAGTGTCAAAGCTTTTTGCATGGAGTTTCACCCCGCTGGACACGAACTTGCAATTG
GACTCAGCTCaggtgagctgctggttgtggaCTGTGATGCGTTTAAGGTAGTACTACGGAAGAATATCAAGTCCAACTCCGGCAGCACAACAAATCTACA
TTTGGGTCTGCCCAGCCGAGCAATCTCTCAGGTGAGATACTGTCCAAATGCAAAATATATAGCAGTGGGGGTGAAGGACACTTTCCTTTACATCTACGAC
ATCATCAATGGCTACAAGAAATTTCATGTTTGCGAAGGTCACTCAAGTGCAGTGATGCATTTAACGTGGAATAAGGACGGCGATATCCTTCAAAGCAATG
CAGCGGATGGCGAGATTCTCCACTGGCTAGTATCTCCTGCAAAGGGCGAAACCAAACAGATAACCGACGCTTTCCTTGTCCGTGATGTTCAATGGATTAA
ATGGACCTGCGTGTTTGGGTGGCCTACGCCTGGTATTTGGTCAGAGGAGACACCCAACCTTGTGGATATCGCTGCAGTCTGCACTACGGGCCCGAAGGTG
GTAAATGAGAATGCCGAGGCAGGAAGCACGCACTCGACCTCAAACGAAGACATGCTGGCTGTCGCTTGTAGATCAAGTGTCCATCTTCTCAAATACCCTG
CTCATCGTGGCGTTAAGAGGAAAGTTTACAAGGCTCACTCATCGACCATTATATCGTTGGGTTTCTCGTTTGATGATGCATATTTAGTTACGGTCGGTGG
CGACGATGGAACCCTCATGCAGTGGAAAGTTGTGTCTGGAGGCACAAGCTCTGCTAAGGTTGGTGAAAAGGCAACAGAGAGCAACATGAAAAATATACTT
CGACTGCAGCTGACGAAAGACGACAGCATCGGAGAACAGTGGTCAAGCTCGAGTCCTGTGCCTCCTCCACAAGAGGACAAGCAACGATCCAGTCGGCGGT
CCCCACGAAAACAATCTCGACAGTACCGCGAGCGTCCAATTTATCAGGACGTCAGTAGCCAAGAGCTACGCGTTGCAGAAAACGACAGCAAAGAACAGGC
AGCTGGTGTAGACAGTAAAAGTTTGCATCAAAGACCGAATGATGATGAGTCAGCAATCGATTTGTCAGAAGACGGACGACAAGCAGGTCCAGGGCCACCA
GTAAAGCAAAGTACCAGCTATCGAGGCACCGCAGATCAGGACGATCTACTTCCTGCACCCATTCAAGTACAGGCGACTCATGACTACGCAACCGAAAACC
CAGACGAACTGAGCCTTAATCGTGGTGAGATTGTCCGCGTGCTCTCAAAAGCTGGTGGTGACTGGTGGTTGGGCGAAACCTGTGATGGCACCAAAGGTTA
TTTTCCTGCTAGTTTTGTAGGAGATGCCGATCTCCGTGCCCCCGTCGCCATTGACGAGTCGATAGCGAACGTGGAGCAGCTAGCAGAAGGTAAACTAGCA
GAAGATGAAATGTGATGACATTTTAGTTGCCTTGAAGTTgtctgcgacgtgtgagaAGCAATGGCTACAGTTTTTGGTGGCTCTAGTCAGCACCACCTGG
TCCCGAATCACGCAAATCACCAATTGCTCGTTCGATGGCGACGCCTTCCTCCGACACGGCGCTGActgccagcacgacgacgttcaGCGACCTCCCGTTG
CATAGCGATGTCGTTCATGCACTTACAGCCATGCGCTTCGTGCGTCCGTCGCCTATTCAGCTGCACGCGTTGCCCGTCGCTCTGTTCGGGAACGATGTCG
TTGGCCAGGCCAAGTCCGGCACCGGCAAGACTGCAGTCTTCGGAGTCACAGCCATCGAGCACGCAATTCGCCACATGGGGCACCGATACCAGAAGAcaga
ggagctggtggtgggagATCCACTGGCGCTGATTCTAGCGCCCACGCGAGAGATCGTGGTCCAGATTGAGACTGTGCTGCGCCAATTGGCGCACTACCGA
CCGGAGATTGTCATCCGCACGTGCATCGGGGGGCTGCCAGTGGCTCAAGACCAGGTAATGGAAGTAGTAGACACCGTGTGTTTGGTGTTCGTACTGATTG
AGGTCGCGATGCTGTGCTTGGGCAGATGCAATTGGCAGCGGGGTGCCATATTGTGGTGGGCACACCAGGGCGTGTGAAGGCGCTCGTGGACCAGCGTTCA
CTACCGTGCAGTGCTATTCGGTTACTGGTACTAGATGAAGTCGACAAACTCATGACGCGAGACTTTGAGAAAGATGTAAGGATACATCTGTTGGAATGGA
TGCCCGGTAACTGACTGATTCGGGGAATTGACTGTGTTCACCCTTTTGCAATGTGGAATAGATCCAGTACATCGCAGACGCTATTCCTGAAAGGCGGCAG
GTGGTGCAATTGTGTTTACAGTAATGTATCGCTGGTAGTTTCTTACGTTATTGCTGTCTGCTGGATCAGACACTCGTATTTTCAGCCACATTCACACCTG
ATCAAATAATTGCTGTGGCGGAACTAATGAGGACTCCACAAGTTAGTAGATTTGCAGCCAAGCAATTGTGGTAGATTCGACTGTGAAGATCTATGTGATA
CCTCTCACCTGTTTCTTTGCTACTGTTTCGATGTCCAGATCGTGCGAGTACGAGGCCCGGATGATGTTGCAACCGAGTTTATTTCGTCGGCTGAAGATCT
CGCAAATTGGAAGAAACGAGAGCAGTCAAACGCGCCAGAACTCTGGCTTCGCCACGTGCGGCAGTTTTACAGCGTTATCAAGTCGTCCCCTGCATCTGCA
GGAGTGGATGATACACTGAACATGAAATCcaaggtggtgaagctggcagcgctgctgtcggaaATCGTGTTTGTGCAGTGTATGGTGTTCTGCAACGACA
AAGTTCGTGCTGAGGCATTGGCCACAGCTCTTGCTGGGCAGGGTTGGCCGGCAGCATGTATCACTGGCTCACAAGATCAAGCTACGCGCTTGGAAGTAAT
GGAAGACTTTCGGGCATCGCGCTCACGTGTATTGGTGTCTACCGACCTCACTGCGAGAGGCATTGACGTTGAAAAAGTCAACCTTGTGGTACGAAGTAAA
TGTGGGGTTGTATGCTGTCATTTTGAAAACAAATAAGCCCCTGATCGTCGATCTACAAACCTGTAGGTGAACTTGGATTTACCGCGGGACCCAGCAACGT
ACTTGCACCGTGTTGGAAGAACTGGCCGCTTTGGTGGGAAGGGGTTGGCAGTGACGCTGCTCTCACTTAATGAGGTGCAAGGAATTCACCTTCTCGGTCG
AGTTTTTAAAATGGAAATCAGCGAGTTACCAACTCCAGTTCCTCCAGAGATCTATACGTATGCAGCTGCAGAGGAAAAtggagacggtggtgaagctgaG
CAGCCTGCAGCGTGTGTCATCGCTGAAAAGTTGTCAACTAAAGAAAGTGACATCGAGACTTTCGTTTACGAAAACAAAGTGGAGAATATCCAGGATACCA
GCCTGAGTGCAAAGGAGGAAGTTTTGGTGGACAAGTCGTTGTCGAGAGAATCTCCCGGCCATTATGAAAGGGAGGAAAAATCATATGAGAACTGGATGAA
ATTACTGTAGCTACCGCTAATGCTGCTCATCTCTTGACATGCAATTACATGCAGATCATCTTGTGCAGTTTCGACATCACCATGCAAACACTTCAGCACG
TGATGACGGTCGTCTTGCTTATTTTTCGTTGTGCGATTGCTTCAGAGGTAGCGAACGAAGTAAAGCAGCGCAACTGTGAATCTAGCGGAATTTCTTCACA
ATGCGGCGCAAAGTGTTCACTGTTCGAACCGTGACCGAAACACCCAATTTCTTGTCGAAGGCCACCTTGAACAGTGGGGACTCGCTCATTTTGGTGGCTG
AGTACCACACGAAcgccttgtccagcagctcgagttcgtcggcgtcggtgGAGATACCCTTGAGGATATCTCGCTGCTCCGTGGTCAGTTCCTCTTTCAC
CAGGACCACATTAACCGCCGTTGCCGACTTCATAACCTGCTCATCTAGCTGAGCCACCTCGTCCATGGAGCGAGCGAACACTGGAATGTGGCATCCGAAG
AGCTCCTCGAGCGCGTCCTCGACCCTGTGTTCAATGGCGAGCACCGAAGATTTGTCCTCTTGAGAGCTGTCGGCAGGCGCGTCGAAGATAACGTTCCCGC
TAGCAAGGAATGTCTCGACGTTGGTGAGTCCGGCCTTGTCCAGTGCGGCAGCAATGGACTTCATGCTGTGCACGCGGCCCCCGACGTTCACACCGCGGAG
GAACGCCACGATCTTTCCGccgccgctggtgctgcccgacgacaacgaagaagTTTCATCAGCTGCAAGCACTGGCGGTCGACTGTCCTCCGCCGTGCCA
GATTCGACTGTAGCAGTAGCGGCACTAGAGCGcgtggtcttcttggctttgGGTGGGCTGTCCGcccgagaaggaggagccTTCCTCTTGGCCTTGCCGG
CCATCGTGAactcagcaacagctcgaagaaaGGAGAATGGCTGCATGGACTCCTCTGCCGGATGCGCTCCAGTATCCAAATCGTAGCCATGTAGGAACAA
ATGTACCAAGTGTCAAAATTCGTCCACAGTTGTCCTTTTTAGTAACCCTGCGATACTGTATTACGCCGTTTGTATCAATTATTGCTGTATCACTTGATCG
TTGTATCGAGGACCGAATCACTCTCTCTAATCCAGCCCCGTCCAAGCCAATTTCTGCGCATTAAGCTTTTTGTTCCGCCCTAGAAGCGCATAACCGACTC
TCCTATCGGTCCCGAAAGCTTCTCGCGCGGCTCGCTTCAAGGCTCTCTCTGCCGAGGCGTCGCCTTGACTAGCTCTGAGTGCCCGCGCGCTCCACATCCG
ATCTTAGCCGTTCCCTGACACTGCCCAACCTGCGCTAGTCATGACCAccggcagcaagaacgagCTGGCATCATCTTcggcagccaccaccacgtcgtca
tTGTCCTCGCTCTCTGCTaccgacaccagcagcaacaataaCGCGGCGTCTGGCAACTCACTGCAGAAGTACATCTCGGCCAAGgaggtggcgcagcacc
aggtcTTCCGGCAGCACGACATGCGGCGCTCCATCAGCTCGACGCAGTTCAGCGGCGGCCGCGAGAGCACGTCCAGTCCCGCCGCCAAAAGCTCCAAGGC
CTCGGTCGCCGGGTCGTCCATGTCAGCCTCCAGCAGTCcgcgctgctcgtcgccagcttcgTCGCCCATGGCCGAGTCCATCCTCAAGGTGGTGCTCATC
GGCGACTCGGGCGTGGGCAAGTCCAAGCTCGTCATGCgcttcaccaagaacaagTACATGCCGCACAGCGTGCAGACTGTGGGCTTCGAGTTCGCGACCA
AGACCATTCGAGTCGGGGATCGACGACTCAAGGCACAGATCTGGGACACTGCAGGACAGGAGCGATTCCAGTCGCTGACGGCCGCCTACTACCGCAACGC
AGTGGGCGCCATGATCGTGTATGACATCACGAACCGCAGCTCGTTCGAGCACGTCACAGGGTGGCTAGCACAGGTGCACGCGCACTCGCACGAGAGCCTG
GTGCTGATCCTTGTGGGGAACAAATGCGACCTGGCTCACTTGCCCGAGAGTAGAGAGGTGTCGACACTTGAAGCGGCGAGGTTCGCAGCGAAGCATTCGA
TGGAGTTCCTCGAGACGTCGGCTTTGGACTCAACCAACGTCGTTGACGCCTTCAAGAAGATGATTGTGCCTGTGGGGCGTTTGCTGTCGCCAACTGAGCC
GAAGAAAATCGCGCGATTACCCCCAGGATGGCGTCGTGTTCTATCAAGAACCAGGCCGGGTGAATACTCGTACGAGAACCAGTATACCAAGGAGCGGATC
TCGTTCGCGCCAAAAGAACCGGCGAAGCCCTCTCAGCAGAGCTTCCGAGCGCCTGCTAATGGCTCAAAGAGCGGCTCCCCGAGTGTCGTCACCGTCACAC
GCGAGAGCCTCCAGAGACAGCATCAGAAGGCGTATCTCGCACAGAACCAGACGCCGCAGTGTGGTGTCTGTGCAAGTAACTGCACTATATTGTAGTCAGG
CAGATGCTGGACGGCTTGCCTCGTGGTCATCAGGCTGCGGGCAACCCGTCCTCTTTTCCGCTACCAAGCCAACACAGTCAATTACTGTCTGCGTCTGGCC
CAGGATAAAGCAATGAGTATGTGGACCAGTCGCAagaatgaagacgaagggTATCCAGGGTCAAATAGAAGCAGGCTAAAGTGCATTTTTCAGTGTAATA
AGGTCGAACTGCCGCGTGTTTGCATTGTGTGATCACTTCGTCGGTTGAAAGAAAGGCTTGGTTATTCGACGATAATTTATTCCTCATTTGAAAACTTATT
ACTGTAAGTACAGGACAAGCTCAAAGACGGTTTCTTCGCGTTGTTGTATGTCTCTATGAATGTTCCGCCATATAGTGCACATGATGGATTAAGTCTGCTA
CTAACgcactgctgcaacagccGCACACCGTGTTGTCCTTTACTTCGAGCGCCGAGTCACGaagaacgcagcagcaacggtggcagcggcgagcgCCAAA
GTTGCGAGCTTGCACTCGGTCGGGACCGTTGCCCACAGATTCGCGCACTTACCGCAAGCATTTTGGTTCTTCTTGGCAACAGTCTTGCGAATGTGCTCAG
CCACGGTAGCGCTCGAGTTGTTGGCGACCGATAGCCGGGTGGGGAGTGACTCCAGTGCCTTCAGAATCGggtgctgctcgatctccgCTTCAGCCACACC
AAGCGCTTTTGACACGACGGGCAAGAACTTGCCGTAGTGGGCAGTGCCAACGACGACCACAGCCGAGTTGGGCTTGTCGGCAAGCACGTCCTGGCCGAAG
TGCATGGCAGCAGCCGCACCAATAGCACTGTGCGGGTCAAAGATGTAGCGTTGCACCTTCTTGTACTCGGCAATGGTGGAGCGCACCTCCTCCTGGAGCA
CCGCGTACGACGCCATCTCGTCCTGCGCCTTGGTTAGCAGCTCGCCCAAGATCGTGAGTTCTCCGGTTTGCTCGAAACCCAGCATCCAGCCACGCAAAAT
ATCGTGATTTTCGCCGGACAGAGCGAAGAGGTAGCGCTCAaagttgctggagacgcagatGTCCATGGACGGCGAGATGGTGTGCTCAATGTCGCGGCGG
TGGTACTTGCCCGTGGTGAAAAAGCGGTGCAGAATGTCGTTCTCGTTGGTGGCCACGACCAGCTTGCCAATAGGCAcgcccagcttcttggcgtagAAGC
CGGCAAGGATGTCGCCGAAGTTGCCCGTGGGGACCGAGAAGGCGATCTCGCCGGTCACGCCCTGCTCGCGAGCACGGAAGTAGGCCCACACGTAGTAGAC
AACCTGCGCCAGGATACGCGCAAAATTGATGGAGTTAACCGCGCCCAGGTGATACTTGGCTTTGAACTCGGCGTTGGCGAACAGGTCCTTGACAATGGCC
TGGCAGTCGTCGAACGTGCCCTTGACTGCCACGTTGTGAatgttctcgtccagcaccgtgGTCATCTGGCGCTGTTGGATGGCGCTCACGTGTCCCTCTG
GGAAGAGGATGAACACCTCGACGTTCTCCTTACCACGCAGGCCGTAGATGGCCGAGCTGCCCGTGTCGCCGGAGGTGGCGCCCACGACCGTGATCTGATG
CTTGGGGGTGCCAGCGGGCAGCGCCTcgttcttgcgctgcaggaAGAACTCGAAAAGGTTGCccaggaactgcagcgcaATGTCCTTGAAGGCGAACGTG
GGGCcgtggaagagctcgagcaCCACCATCTGGTCCGTGATCTTGACGACGGGCGCCACCTCCTCGGCGCGGAACGTGGTCGAGTTGTAACTCTTGGCCA
CGAGTGTGCGCAGCTGGGCGCGCGAGATCTCGCtttcgtcgatgaagagACCCATGACCTCAACGGCCAGCTCCTGGTAGGAAAGCGACGCCCActtgtc
cagcgcgtcggccGGTAGCGTCGGGAACTCGTTGGCTTCGGGCACCAGCAGGCCGCGGTCGGCAGCCAGACCAGTGAGCACCGCCTGCTCGAAGCTGAGG
CCGCGGACGCCGCCGCGCGTACTGCGGTAGTGCACCATTGTTTGTgtgtggtggaggtgggGGTGGGGGGGAGTGGCGGTGGAAAGCGGGCGAGAGGTGA
GAGCGCAAGTGGCACGGAAACAGCTCAACACTTGACCGGCCCAGGAAACTTCTTGCAGTGGAGACGCTGCTACACCGTGGATTCCACGATGCGGTTGTAA
CGACATTCAAACGACATTAACATTGCGCAATCCGACATCGGCGCATGCGACGTGGCAGGGATGTTGCCCAAGCCGTGGTGCACACTAAATGGAGTGGGAT
ACATGAACTGCTTTCTAGCAACTTAAACCAATGTGAACGTCGACTGCGGCCGTCTAAGGCTGAGGTCTTATTGTCGATAGGCTGATCTGCGCTGCACGAG
TTTTCCTGGTTGGAAGCCATAAGACTAACGGTATAAAAAAGCAAACAGGGAAATAAATTTCGCACGGTATTATCTCCCTGGGGTGTTCCACAGACTTCTT
CCTGCTGTCGTCCAATGGTTCATTCGAATCCGCATTCCGTTAGTGTCTACCTCAACTTTCCTGATTGGATCAGTTCTGGCCAAACTGGAACATGGTGGGC
TGGTCAGAGGATGTGCCGAACTGGAACTGCTGTGCGCTCGCATCCGTGTCGGGCGCTAGGCTATCCTCCGCATCCTCCTCGCCGTTGAAGTATGATTCCA
CAATCTTCATGGACTTCATGTAAATGTCTGATGAAAAAGAACCACAGATAGTTCGTAAGCACCCGCGCAAAAATAATTACACCCACACGAAACAAATGGA
GTGTTAACTTACCTTCGTTAGCGTGGTACTGCAGAGCCTGGATCTTGTTCACGCCATCGGCTTCATCGATCATCGTTGCAATGTCGTTGATGTCGTTGGT
CTTCTGCTGATCGCCAGCACGCAGAATGTTCTCGAGGCCCTCCAGAGCCACAATCACAACCTTCGCGTCCTTAACCTCCAGCAGGTCGCACAAAGGCTTG
ATGCACCCTGCATACAACAAAACAAATCTGCGTTAGCAACAAAGGAAAAAGAATAAGTAGTGAGGCATTCAATGCCGCTAAACTTACCTAGAGTGACAAG
GTGCATGATCTGCTCCGCCGACCCACCAGACGTGGCGTTCGACACAGCCCACGCGGCTTCCTTGCGGATGTCAAACTCGGCCGTCGACAGAAAGCTGATC
AGGGATGGAAAAATGTCGGCCTCAATAATGAACTGGATCTGTTCCTGGTTGCCGGCCGTGATGTTGGAAAGCGTCCAGCACGCCTCCTTTCGGATCCCCT
TCTTGGGGCTCTCCAGAAGTGCACGCAAGCACGGCAGCGCACTCAGGTTGATAATGACCTGCGTCTGTAGATCGTCGCCTGTCACGATGTTACCGACCGT
ACGCAGAGCAGGCGTCTGCACGGATGGAGAGTGGTGCATCAGCAACTCCACAATTCGCCGGCACACACCAGCCTCAATCACGGCCTGGATCTTCTCGTTC
GAGCCGTCCGAAAGGTACGATAGAGCCCAGCACGCGTCCGTCAGCACTTCTTCGTCGTGGGTGTAGATAAGCTGGCCCAGAGTTGGAAGCGCGGGCGCCA
CGAGATCGAACTGCGGCTGAGGCTTGCCACGGCAAAAGTTCGACAGCGTCCACGTAGCGTTCCGAAGCATCGTTGGCTTGGAGTTCTCCGTCAGCTGTTG
CATGAGCGGGCGCAGGGCACCGCAACGCAGAACCATGTCACGGCATTCGATGGAGTCACCGGCAATGTTACCAAGAGCCCACACAGCCTGCTCGCGCACA
TCGTCGTTCGTGGACAGCAGTAGCTGGCAGAAAATAGGCACAGCGCCGTGATTAATCACCACCTCGGTATCCGCTGAGGTACCCGAAGCAATGTTCGTCA
AGGCCCAGGCAGCCTCAAACTGCAGCGTGGGGAAATCCTCGCGCTGAAGGAACTGCACGAAGATAGGGACGACACCGGTGTCGATCACCTCCTTAATAGG
CGGATTACGCTCTGCAAGACACAGTACAAAAGTTAGCCATCGTCCCATCCAGTAGCTCACACTGCGTATCCAGAGCTCACCAATTGACAAGAGCTTGCGG
AACTTGGTCACCGCCTCAAGTTGCACAGCCGCGTCGCTCGACTGTACACCCGACACCATCTGCGGAAGCTCCGATAGCTGCAGTACCACAAAAAGTCAGT
TCACGCCCTCTCATGTCTACGCTTCTAGCTACAGCCTCCTTACCCGCTGCATCAGCGTCAACTCTCCGGCGGCGTCTCCCATGGCGGGCGTCGCCGCAGC
TCCGTTTTCCGCCGgcgtctgcatcagcaacgtCAGCAAAATCGCAAAGCAAAACTGAGCCTTCCCACTCTCTCGCAGCCAAATTCAACATAAGATACGA
AGCGACTCTAAGACTGCGGAAGCCATCGATCGTTGGAGGATGCTGCCCATACAGAGTCGCCTGTTCCTTCTTCTCTATTGCCGTACCATACGGCGGCGTT
GGTTCATGCGGTCCTCCTTGATGGTCTTGCGGATCTGCACGGTGGTCTCCATGCGGCTGCGACGCGACTCATCGGCGTCAATACccttcttgaagaagtt
cttgCGCTCCGGTGCTTTTCCTGCGGGGAACGACATGATCTGCTTTCTCTGTGCCTCGACGGGGCCGGGATCGGGACGCTAGCTTGGAGCTGCGCGGCTT
CTTTCCTTGTTTCCCCTTCTCGAAGGCGCGGTACTGGCCGCCAATAAATTGTTTTGGGTGTGGGCCACACAAATCAAAGAAAACAAACTCTTTACAAATA
TTAAGAGGTTTTACTGCAAAGGCAGAGGAAAAACCTCGGTTCGCCATACGCTGATATCATTCAGATACAAGTGTAGCCACTTCAGCCAAGAGGCGCGGGG
CGGACCAAAAGTGCAAGTACGTGGCCGGGATGAAATCGAGCGCCAAGCCGCTGcccgctgctgccgatgcGCTGCCcgcgtcttcatcatcgtcgcgCAA
CGTGGTGATCCACGTGTTCGACGAGTACcgcaagagcagcaaggagTTCCAGTGCCAgcgcgacctgctgctggccaagatgaaATACTTCCAGGCGTAC
CTGAACGAGGCcaacgagcacgacgagatcgacaTCTCGGTGCACTGCGACGTCGAgatcttcgagctgctcatgCAGTACATGCATCAGCGCGACCACG
AGTGGCGGCCGCGCATCACGCTCGAGAACATCGCGTCCATCCTCGTGTCCTCCGAATTCCTGCAGATGGGGGAGCTCGTAGAGGAGTGCGTGGTCTTCAT
CTCGGGGCGCGTGCAAGACTTTATGCTGTTGCGCGTGGACTTCGGCTGTCTGTCGGATGCCACGATCGCCAAGATCGCCAGCAATTGCACGCCCGAacag
ctgcaggcgctgcaagACCCGAAGGACAAGATCCTGCCCAAGCTGCGGCGGAAGAAGGTAGAAGCCCTAGTGAAAACGCTACAAGATGGTGGACGGAGAC
TCGAGCTATGCACGAACTGTGAGTTGCTCTTCATTAGGGACGATAGAAATGCTGTAGGCTGTCAGAAGGGTAAACGTCAGATAGGTGTGCATGGCAAACT
GGGTGGAAAGCATCAAGCGAAAACGGGATGGCAGGTCGAGGTATTTCTGCGAGAGCTTGGTGCCGACAAGAGTCTCTCCTGGAGCGCGGCGTACTGGTAC
ATCTGGGGATCCACCAAGTATTTCCACTGCTGCGTTTGCAAGCAACGGTGCTGCTTGTTACAGCTGCGAGATTGCGCCTACCACCCTGGCTCCATTGTCG
ACCACGGTCCGTCTGCCAGATATTCCTGTTGCAGCGCGCAGATTTTCAGCGCTGACGAGATTTCGATGCGTGGTTGCAGGACCACCGCCCACGTGCCACT
CCATGGTGACAGACACGCAGAAGGGGGCAGCTTCAGTGACGCTGTGGCACCTCCGAATATGTGGGAAGAGATTCGTGCGTGTGAAAAAGTAGCGAGAGCT
CAAGGCCCTCACTctggaggagatgcaggcggcggcgggAGGATTGACGTGGCCTCGCTGTTTCCTCAGCCGAAGAAAGGCATCGCGAACGACATCGAAC
GCGAGGCGTCATCTAGAAAGCTGAATGTTGCTGGTGAAGGCAATTCGTCGGGCTATCGGAAGCAAtgcaaggtgctgcaactgcaggaGAAGGATCGTGT
GCGCTGCCAGGACATCGCGCggcagctggtgctgcaacggAAAAAGGCAACTTCTTGATTACGTACGTGCAGCAATGTGTGTTCGATACATCATATTCCA
ATTTGATCAGCGGTTGGCAGTTGACAAGTCAAGTGACGATGTGGAAGCGGCCGCTGCGCGACGTAGTGGTGCGCTGCCATGTGGGCAACCTGCGCGTGTC
TGGAGTGATGGCGCGCAACGCAGTGGGGGAAGTTtcgcggcggtggcgacTGCCGCTCGCCTCCGGAGGAGCGAAGCTCTGGGGCGAGTACATGGCCGGA
ACAGCCATGCTCAGCTCCTTTTTCAAGGGCGAGGAGCGCGTCAAGTTGATGGTCAAGACGCCCAACATCCAGGAGCTCTACGCGGAGGCCATCGCCGTCG
GAGAGGTCCGCGGTAAAGCCGTCTACGTGGATCAATCTCTCGCTGGAGCGCCGGAAACCGGAGGATACATGCACGTCTCCAAGATTCTGTACGGCGCAGC
CAAGCCATATAACACGTCCATTGAGGCATCTGGAGTGCCTGAGCTGGATTGGCAGAGGTTTTTTGACGTGTCGGAGCAGGTCCCGACCATCGTGCGCATT
GATAGTGAAGCCGACCAAGACCATACGCGCAGCTGTGGTCTTATCGTCCAGAAAATGCCACCAACAGAAGCACACGAGCGCCACTACGAGCTAGAGGAGC
TGGCGTTCGACAAGCTCCCACTCCTAGCCACtgagttgaagaagaacacggaCATGCTGGAGTATTTGAACGAATTGATTCCTGGTGCTGACATCACGGA
TAAGACCTGCAAGCGAGTGCCGCTGGATTACTACTGCCGCTGCTCCAAGGACAACTACGCACAACGCCTCAAGGATATGGGCGCCACTGATCTGAAGCAG
ATTGCTGCAGACGTAGGCAACGCTGGCGTAGAGCTCACCTGTCATTTCTGTAATGATGCACACCACTTTTCTGCTGTGGAGTTGGAAGGTCTGATCAAGT
CGCTGTCCGAATCTCAGAAATAAGCAAGGAacgaaatacatgtaagtatATCGAGACGGTTATAGAGAGGTGAATGTGACGAAGTCATCTGTCTATGTGT
TGGTCTAGCCGTCTTGTCCAAACTcctgcgtccacttcacgAAGCGGTTGAGCTCATCAGGGGCGACAGTTGCTGTTGAATGCTCCAGCACGCGTGTGAA
GTCACTCTGTCGTAAAAGCACAGTTTGCTTGAGTCAGTGGCGCGTAGCGAGGCGAGCAAAGTGAAAACCAACGAAATAGAGAGATTCTTACCATTGAGAT
CATCGGGGGGCGCAGCTTTTCGTCGGAGAAGCCACGCTCCGGCAGATCGTATAGCCGCATGCGTAGTGCCCCGCAACGTCGGCACGGGGCCTTGCAATCC
GGGCATTTCAGACGACATGAAGAGAGCTTCATGTGGCAGTACGCGCACGGTGGATCGTCTTCACACGGTGTCAAGAATGGGCCATTCCGAATAGGGTGCG
CCTTATCATCACACTGAAAGGCAAGAAAAGCTCCATGTCAAACTTACAGGTAGAATACAATTTCAGATCTGAATCAATAAATCACTGCCACCCTTACCGG
AGCAAAAAATTGGGCTTGTTGGCACTTTCGAAGAGGTTCCATTAGCGCATCTCGGACAAGCACCGAGATATCTGAACCAGAGCAGCTGAggaaacagcaa
aaaaacaaaagtCAACTCGAGGGTCAACCTTCCCCATCAAGAGTGCTATCGTGCCCTTCCGTTTTCTCAGCGATTGCTGTGAAGTTTGCATTGCTCAATT
TGTTTGGTGTATCGCCAAGGTGGATCCCCAGCATCACCTTCCGTGCATCTACTTCAGGGAGAGGAATGTAAATGCGCTTTTCGAATCTGCAGGCCACAAT
GCAACGCCAGTTATTTGCTGCCCTCCCTtcttaaaaaaaaaaacacaataCAAACTAGTAGGCACTTACCGTCGTCGCATTGCTGGATCAAGCTCCCATG
GTACGTTCGTAGCTCCGAGAACCAGAACACCGTCATGGTTGTTGCCCATCCCTTGCATCTGAACAAGGAATTCATTCTTGATACGGCGTGTCGAGTCGCT
TTCACCTTCAGATCTACTCGAGCACAGCGAGTCGATTTCATCTATGAAAATGATAGCAGGCTTCTTTTCACGCGCCATCTCAAAGAGGTTCTTGACCAAC
CTAGTAAGCAAGACCTGAGTGAGTCAACGGGAACTTACACTCGAGCTTCATCGTAGAATTGGGTATCATACTTCTCGCTCTCGCCTTGCCACTTGGACAC
CAAGCTAGAGGATGAAACGGCAAAGAACGTGGCGTCCGCTTCCGTTGCGACGGCCTGGGCAAGGTACGACTTACCCGTGCCTGGGGGCTACAGAGCAAAT
TAACAAGCAGGTTAGTGCACTCTTCACTTCAGTAATGCCCTCAACCAAGCGCTCAAGATCATACCCCGTACAACAGAATGCCCTTCCAGGGACGTCGCTT
CCCCGTAAAAAGCTGCGGGAACCGCGCCGGCAAGATCACTGCCTCTTTTAGAGCCTCCTTCGCAGCATCCAGTCCCGCAACATCGTCCCATTTCACATTA
GGTTTCTCCGATACAACCGCCGCTGCACAGTATCGTCCGAAATCCCGTAAATTCGACAGAATAACAACGAAAGCCCCATAAGTTGACCTCTTGAGCAACA
CTTACAGGCCAGCGAGCCGCGCAGTTTGGCTGTTTCGGCATCCGTCTCGTCATCATCCTCCTTCTCCCCTCTGCACATAGCAATGCTAATATCAAAAGTC
TATTGAAGCCTCACTAGACCCAGGGTAGACTGACTCACTTGTCCATGTCCACTGCAGCTGCCACTGGCTTGGGcgcgttctccttctccagcatcccCCG
CAGCTGCTCTGCGCGCGTCATGTAGCCCTCCACACGCTTCATGATGATCTCCTTCGACGTCGGGTTCTTCTCATCTGCACAGATTGCAACAGGCAGGTCA
GTTGCAGCACTAAAAAAGCGCTGAAGGAAGCCTCCGTCCGACCGTAACTTCAAGCAAACGTACATTTGACGCCGACCATGAAGTGctcgagcgccttctt
gtACAGGCGGAAGGCCTCCTGGTagttcttgttgttgtcttcaTTAATAGCCTGCGTTACGATCTCAATCGCCTGCGGGATGAACTTGTTCTCCATCGCA
GCGCTGACCTTCCTCCAAAATGCAGTGAAGCTCCAGAGGACGTAGAAAATCCATTGCCCAAATGGATACGACATTCGATTGGTCGAAAATAAACCTTgtt
ttcgaccaatcacaatgatgttgaagtcagTCCGTTCGCAGCATTCGGGATATGGGAGTCAGTCAGTCCAAGGGAGgggacagcagcggcgtgcACTGGA
AGCTGCGGCCGCTGGTGCCTCAGTCGTGggaagagctggagcagctgcatctgcgcTTCCAGCAGGAGGCGCACCGCCGTCGAGCCGACCCCATGTTCCA
GTATTTTCTGCCGTTTCCCGTGTTCCAGGCCATCGTGGCACCGCTTTGTCCGGACAAAGACAAGGTGCAGTTGCTAGCCATGTTCGAGGCGCTGGAActc
aagaagacgaggaagctgGCAGTCGTGGACTTCTTCAGTGGGCTGGCGCTCTTGGTAGATGCGAAAAAGCCCCAGAAACTCGAGTGTGAGACCACGTAGC
AGCCTGCGGAAGTTCGGAGAGGGAAGCTAACGTCTGTGGCTCCAGTTGTGCTGTCTCTGCTGGATAATGGAGGGCTGAAGACGCTCAACAAGTGTGAGCT
GACGATGGTGGTGTCGGCCGCGTCCAGGGGGTTGAAGATGTTCGCTCCTGGAGCAGACGCCTTGCAGGAGGCCACGATGAGGCCGCTCATTCGACGTAAA
GGCCTGCCGCGTCCAATTCAGCATTGATATCTGCATCGAAGCAAGCTAATACTACATATCTACATGTGTGCGGTGCAGGCCTCTTCGGTGACAGCAATGA
AGTCTTGCGGCAAACCGTCGTCAACAAAGCTCTTGCTGACCCAGAGATTCTATTCTTCATGAGCGACCTGGAGGCGGTATGTGCCTGATGTTTGTAAACA
TGAGGTAAGCTTATTAAATATTGATGTTTTTTGTTGATGTTTCTTGCTGCATGTATGCAGGGTGTAACAACATCCTCGAAAGAGTTGTTAATACAACAGA
GAAAGCTTATGGGGCATATGGCCTACCTCGACTACCAGGCTGCGCGGGTGACAGCGTCAGGTACTGTCGCCTCTTCATTCTATAACGAAGTATGCAGTTC
TGCTGATTATTACACTGTTGTTGCTCATGCGCTCTGGTCAGAGGAGAGAGAAGTTatagcagctgcagccactccTCTCAACGGGCCCAGTACAGATACT
GAAGGTCAACAAGCACTAACAGTCTCATCAGCCCCCACAGCAGAAAGCTTTGCTCGCAAACTCCAGAGCGTAGTGTGTCCACCTCCTCCAAAGGAATCTG
ACCAGTCGATGCGCGTGCTATCTGCTGTTGAGATTAAAAAGTTTGTCGATGCACGCACGCTCCAGCGGTTGGTCAAAATTGTTTCGGACGGCGGTATATC
GCTCTCACGGCCTGAGGTCGGTGTATACAGTATGCAGCCTGCAGCCTGCATCTAAATGGAAAGGAATAATCTATGTGTTGTTTGATTCGACAGGCAGCAG
TGCTTGTGGGAGATATGGCAGTGGACCAATTTGGACTTGTGCGTTGCAGCGACATCCTTCGTGTTATGAAAATGTGGGTGGAAACCCGACGACGGGAGAA
ACCAGAGGCCCTCTGGGAAATTGTGAGCAACTACGTCGTCGAGGGTGTTAAAAGCACGGAGAAATGCATGAAAGATGCACTTGCTGTTTTTGTCAATAGG
GCGATGAAAACTGGATCTACTGCCCGTCCGCGGGCAACTGTAGCTAAAGAATGTCTTCGTGAGAGCCTACAGAATGTCTCGCAAAATCTTGATACAGATG
ATGATGAGCTTCAGTGGAATCTTAGCATCCGAATTGGTGAGAATGCATTGCCAATCCAAGGGCCAACAAATTCTCCGATTTCGAAATATGTGGGAGTTTC
TCGTGGAGACAAGATCAGGTTTCGATTGGGGATCCACTCACCAAGTAGCACGGATGGTGATGTGGGAGTTAAAGGCAATAAGAACAAGCTCAGAAAAGAA
GGGCCATTAGATTacgacagcgatgacagcCAACTCGAGGAGGTTGACCAAGAAATGCGCCTTATCGTGAATTTTTCGTTGAGCCCGGAGATCACAGGTA
AGGTCCATAATCTTTCTTTCACTTAGCAATACGTCTAATTAGATGCTGTGTCGAAACAGATGAGGAAGGTATTGATTTGGCATCGTCGGTGGAGAAGGCT
CTAAAGCAAGAGCAAGTGTGGTCATCATTTGCATCGCTATGGACAAAATGCTCAGGTTTACATTAACGATACTAACTGGTGGCTGGATCCAAACTGACCT
GCATTTTGTATAATTGCTGCAGTTTCCATGCATTCGGCTGTCCGGAGTGACGGGGGTATTCAACCCGTGATTGGCAAGTATCTTCGCGTCTGTATTAACT
TCCGTGAGGACTTTATCTCTAACGTGGAGGTGGGTTATTGCATTAAACAGTGTGAGCAGGCGCCGCATTTATTTCCTCGTGGTCTAATAATTTTACTATT
TTTTCACCATGCAGGAGTGTACAGGTACATCGTTTGCAGCGGGGATTCGTAGCTTTTTCGTGTTGGGCGAGCTGGAACAATCGTTGCTGGACATCGTGAA
AGTTTCACAGGATATGGCCACGTTGCTGCGCAGTCTTGGAAAAAGACAAAATCGAGAACGCGCGATGAGGATGATTTTTGATGATGTCGATGCAGATCAC
AGCGGTGAATGGAGCCTGCAGGAGTTCAATACTTTCCAGCAGGCGCTCGGAAAGGAAGCTTTGCACGAAGTGATACTAGCGGAGTTGTTCGGAGGAGCCT
CGACAATATCCTTTGATAAGTTCATGACAACGTACGAGAACTACCCAGCTGCAAGACTAGTCGAGATGATCCGTCAGCTCGGAATTGGTAGGGGACAAGC
GCCAGTGTATGGTTATTCAAAAGATAGCGTGAAAACTGACACCACTTTGCTGATATATAGGTTCGCTTGGTAACATGGTGAAGGGCTCCGTATCGATAGC
ATCGACGCTAAATGAACCGTGTGTAAAGGCTCTGGCTGTGTTACTAAGCCCTTTGCGCTGGGCGGACGCGTGCTGGAAAAAAAATCATGTCTTCACCACG
AGCATGAAGGATTTAAACCTCGAGCTCCACTTTTCCAAGCTTGCCGAGCTCGTGCAGAAGTACTTCAATTGTGATGGCACGCTTGGTTTCGTCAGTGACC
CCTTGTTTGTGGCCTCATGGATAGAGCAATACGAGGAATTTGTGCAACTTCCACACGCTGAGCACCCCAAGGATCGACCATGTCGTAGCATATTTTGTTC
ACTAGAGGGTGAAATTAACaagacggagcagcagttggagtTCGATGATCAAAGCAAGAAGCTACCACGAGGGACATCTGCTCGGCGCGCTGAAGCCATG
GTTCCATTTCTGGAAATGGCAAAACTTGTTAAAGCGCACGTTCAAGGACCAGAGCTACTTGAAATACGCAGCAAAAGCATCCGCATTGTGTGCGAGCTAG
ATAACCTCTGGATTGCACCTCCGAGCAACACTCAGGACGTCGATTCTCTCGCTGACGGAGTGAGCTAACCATGGGTAACGTTACACGTATCTCGAAGTAG
AAATATTTGCGAGTGATGCGTAATAATAGGGAGACATAGTGTGGCTGCCATAACAAAGTGACTCGTCAAATTGCTCATGGCAAGCAAGGTTGAGATGATA
TAGAGAAGGCGACAATACCATTCGAGCGATGAATCGTATGCACACGACGATACCGGTCTGCAGAGATGGGGGTGACTTGTCATCCTGGAGCGAAGAGTCC
AAGACAGTTTATGCCCAAGCTCTTCAGGGCCGGCATCGTGGAATGTACCAAGAGGCCGTGAACGCACTGGAGCGTATCATCGAGGTAAGCAAGTGATTTT
AAAACTTATATCCACGTGATATCGTGCTAAGCATTTTTTGgcagcgagaaggtgatTCCGAGAAGCTCTGGACTGAGCTTGCACTCACACAATTCCAGCT
ATGGGAAGCCCACGCCAGAGCACTGCACATGCCTTCCATTCTGGAGCTCTCATCATCAGCACAATCCAAACGACCCCGAGAACCAACTGCTGATGCCAAG
CCATTGCAcagcctgcttcttcaagagGCCTACAGCACCTTCCTCATTGCGATGGAGTATCCAACCAGCAAATCGAGTCCGGAATTGCTGCTTCCGCTGG
CCAGGCTCTATATTGAATTTGGGTCATACCGCGGTGCGCTTGCTGTGTGCACACTGCTAGTGGAAGGGTATCCGACGTCTCCGCGTCTTAATGAGGCCAT
ATTTTTATCGGCGCTTACAGCATCAGCATTGGGTCGCCATCGAGAGAGCGCACAGTACTTCCAATATCTAGCCGAGGGACAGGGACCCTCATTGTCATTC
CCGTATCGTATCGCAGCGTACCAGTTCAGTTTGCTAGCAGCATTGGAGCTCGCACATGTTCCAGGTATGCGTCCACTAGAGCGTGAGACGTACACTCAAG
CTTACAAAGCTCTGGTTGCACTTCCACCAGTGTTACCGTCTGAGAAGACTGCGCACACTTTGTACACGACGTCGAGGAAGAACGAAGAGCAGCGCACATT
GCTATGGTGTCGTGACGTACAGACATGGTTGGACTTAGCCCAGCGACTTGCGGGACCAGCAAATGCACCAATTCTAGTTCTTTCAGCTCTTTGTGAAGCT
CGCCGCAGAACAACACCATTATCAGGAGGCCTACCTGTTGCAAAGCTGCTTCTGGAAGGCGCTAATCTACTGCGGACCGGAGACGATCTAGGGGCAGAGA
GGGTTGTCGCTGAAGCACTTTTGCAACTACCTCGTGAAATGTACTACAGCGCGTGTCATGAACGATTCTTGCTGGAGATATGCAGTACTTCATGGCGTAC
ACACTTCGACTTGGAGCACAGGAGTGCAGCACGTCTGCAAGCATTCCTTCGGCGACGTTGCAAATTGGCGCAGTGGCGCCTCGGTGTCGCATATGTTTtg
gagcagcgtcgccatGCAATGACTGTACGTATTCAATGCGCGTGGAGAGGGTATAAAGCACGGAAGGAGCTTGCATTCTTGCGCGAAAAACAACGAGAGA
AGGAAGCTCTTGCTAATTTAGCCATGGGTGAGCTAGACAGCAGGCTGATCGATCTACGGTTGAATGCCGCTGCAAGGAAAATTCAATCGTTGCTTCACAT
CTCGCGAGGTAAGCGCACACttcgagctcttcgagcACGGAAAATTGAACGCGAGGCTCTTTTGGCAAGGTTTGCGGGCCGTCGCACCGAGCTTGGTCAA
CTTGGAATATTCCGTACGTGGAGGATATTTGTTTCAGCTCAAAAGCAAAAACGCctcgatgctgctgtgcgtaTTCAACGACAAGTGCGTGCCTGGTGCA
GCCGCAAACTCTGCCTtcagttgatgctgctgcgtcaacaGCAAAACAGTattctgcagcagtgccTCGCCCGACGTTCAATATCGCTGATCTCACGCGT
GTTTCAAACATGGCACACCGAGCTTGTCGAGGCTCGAAACGAACGCGATTGGGCTTCACGGCGCATTCAACGTAGATACCGCTCAAGGCTAGCAGTGCGC
CAGTATCGTGTCCAGCTACGACGCCACCGGGCTGCAACCGCCACAATGAACCGATTGCTCTCAGATCGCCGGCAGCAAATGTTGTTAAGTTCGTGGCAGG
CACTCGCAAACCACGCGCTTGTCCGTCATCTGCGCAAGCGAGGTGCAGCTGTGACCATCCAGAAGCACGTGCAAGGTGTACTCGCCCGGCGACAAGCTAA
ACGACTTCgtgcacgtcgtcgacgagctctCAATGTGTTGGTAACGCTCACGCGTTCGCGCGAAACTCGGGTTCTGCAAACAGGATTTGACTTTCTTCGT
CAGCACGTTCAAGCATACCACAGAAGGAGGTACGGAGCTGTGATTCGCATCCAGGAGCTCTTTCGGGGGGTTCGCACTCGTCAAAGGCTGCATCGACGGA
GTACAGCAACAATACTGGTCAATGGAACCTTCACGTTTGGCAGTGGGCTTAAGGGCCAGCCCCCAGATATTAAACTTTGGGCATGTCTGTTAGCGCTATC
ACGGTATATCAAACAGCGAGATGTTGCCAGAGTTCAATTACAACAATGGTGGAGACAGCGGCAAAAGCGCGCTCGAATGCTTCGAGTGCTCAGTAAACGT
GCAGCCCAACGAAGACTGCTCGGCAGACTGCAGCAGAGTTTCTATACCCTTGCAAGAAGTTTCTTCCGGGAACTTCGTGCAGCATGCAATGCCAAAAAGA
CCCGgcaacacgcagcagcgaccaaAATCCAACGCCGGTTACGATGCTGGCTGATGCGCCGACGGTACCTCAGCACTCTCGACAGACACTCGATCGCTGA
TCAATGTGGCGAGAAAGCAGCGAAGAAATTAGCGCTTCAAAGGGTGCGTCGGTTGTTTCATGGCTGGCGAGAAGCAACACTGGAAACTCggcgagagcag
cacgaggcaGCTTGTCTGGTACAGCGAACATTCCGCCGTCATCGGGCACAGCATCAAGCACGTTGTGTCGTGGCGAAAAAGGCAGCACAGGCAAGATTGT
TGGTCGCAGCTTCACAAAAGCCATTGGAGCGCTGCTTCCGTCAATGGGAGGCTGCAACCCTGCTCGAAAAGAGTGTGCTGCGTGTACGCAGTTCATCGCT
GATGGGTTCAAGAGAAACAACCCCTGTGAGCGGACAGCGGAAACCTGGAACTGCGTCCGGAGCCAAGTTCGACAAACCATccacgctggaggaggtaAGC
TAGTGCATATGTCCTTCCAGTGCGTTGACAGCGTCACTAACCGCATGACTATCTTGTGACAGCGTGCCGAGATCCCGTCTATGCTTTTCTTCACGTTGCT
TAACCGCGTGCGGCAAAGCGGAATATGCCAGCTCTCGTATAGGTGAGTGCTCGCAAACAAACGGGGTGGTAATCGCTGTCAGGATCTCCAGCCACTCACT
CCCTTTACCCATTCAGCGGCGGCACTGTGTTCAAGGGACCCCAGCTCCGACAGTTGATTTCTCTATCCACCAGCGTCATTATcgacggcggtggcggcCT
CTCCAGCGTCAGTccagcatcaagcagctcgctTCTCAACCTCAACGAGCAGGTCGTAGACGCCCTGAacgtgagctccagctccacttccagccCGTGT
CCGGTCCAATCCCTCATCCTGTGCAACGCGCCACTCCGGCCTTCACACACGTCTCTCCTAGCCACCATCCTGCAACGCAGTCGTCGCAGCTCTAGTCTCG
CTCTCGTGTCCGTAGTGCTGGCCAACGTCCCGCTCGCTCCCGCATCCGTCGTGTCCCTCGCCTGCGCATTGGCCCAGAGTCCGAGCTGCCTGCAACAGCT
GGTGCTCGAGCGTTGCCAAGtcggcagcgccagcgccgccgcaTTATTTGAGGCGCTGACTTACAACCGCGCGCTCTGGAAGCTTGACCTCAGCGGGAAC
CACATCGCCGACGCTGCGTGTCCTGCTCTAGCGCGAGCGTTGCTGGCTGGCAGCCCACTGCGCGTGTTGGCGTTGAGCCGCAACTTTCTATCGGACCGCG
GCGTGCTGGGCTATCTAGCCCCAGTACTGGCTTCATGCCAACTGGAGACGAtcgttctgctgcagaaccCGCGCGTGTCGTCGCTAGGCGTGGCAGCATt
acgccaagcagcagcagtagcaccTCCCGATCAATTACGCGTCGTTTCGGATTGAGCGCTGTGATTGGCGGATAACATGTATCCATCTTGTCACTGATTG
GCTGCAAGTGGGTGGAGGTACGAGTGTCACGCTTGGTGGCTAGGAGCTTTTGGCTGGTTCAAAACCGAACACGCCGAAGACCTCATCCGACCCCGTTCAA
CATGGCCGACGCCTCTCCCGTGACCAACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAGTACAGCCACCTGATTGCGCGCCgcgtgcgcgagctg
cacgtGTTCTGTGAGCTCTACTCATGCCTGGTGAGcgccgaggagctgcgccagcaccagctcaCGGGCATCATCCTCTCGGGCGGCCCACAGTCCGTCT
TCGATGAGGGCGCGCCCCACGTGGACCCAGAGGTGTGGAAGCTCatcgagaagcagaagctccCGGTGCTCGGCATCTGCTACGgcctgcaggagctggc
cTTCACCAACAACGGCGAGGTGGCGCCCTCGCAGCACCGCGAGTATGGCAAGGCCATCGTCACCCGCAAGGGCAGTGTGGACTGCGGCGGCCTGTTCGAC
GGCCTGCCGGACGAGTTCCAGATGTGGATGAGCCATGGCGACAAGCTGCACACCAACCCCGATGGATTCGTGGACATCGCCACGACCGAAAACTCGGAGC
AcgccgccatcgtcaacGTGGCGCGCAAGTTCTACGGCATCCAGTTCCACCCGGAGGTGACCCACAGCCCGCTCGGCAAGGACATCCTGCGCAACTTCGT
GGTCAACATCTGTAACTCGCCCACGGACTGGGACATGCGCAGCATTGCCGACGCCTTCATTGAGGAGGTGCGCGAAACGGTGGGCCCCGAGGGCCACGTG
ATTGGCGCCGTGAGCGGAGGAGTCGACTCGTCCGTTGCtgccgtgctgctgcagcgcgctcTTGGCGACCGCTTCCACGCCGTGCTCATTGACAACGGCC
TCCTGCGTAAGGATGAGGCTGTGGAAGTCGTCGACCGTCTGCAGAGCAAGTTGGGCATCAACCTCAAGTGCATTGACGCGTCGGACCGTTTCCTGGCCGC
CCTCAAGGGTGTCACGGAGCCTGAGACAAAGCGGAAGACGATTGGCAACCTGTTCATTGAGCTGTTTCAGGAGGAGGCCGAGCGCATCGGACACCCGGTG
GActacctgctgcagggcACGCTGTACCCGGACGTGATTGAGAGCATCTCGTACAAGGGCCCCTCGGCCACGATCAAGACGCACCACAACGTTGGTGGCC
TTCCGGAGAAGATGCACCTGAAGCTTATTGAGCCGCTTCGCGAGCTGTTCAAGGACGAAGTCCGTGAGCTCGGTATGGCTCTTGGCATTGACGAGCCCAG
CGTGTGGCGCCACCCGTTCCCGGGCCCAGGCCTTGCCATCCGTGTACTGGGTGAGATCACGCCTGAGGCGCTGGACACTCTGCGTCACGCCGACTCGATC
TTtatcgaggagctgcgcaacaGCAACCACTACAAGACGACGGGCCAAGCTTTCTGCGTCTTGCTGCCGGTTAAGTCCGTGGGTGTCATGGGCGACGGCC
GCACTTACGAGAAGGTCGTTGCCATCCGTGCCGTCAGCACGTCGGACTACATGACGGCCGACTGGTACCACATGCCGTACGAGGTGCTCGGCCGCATGTC
CAACCGTATCATCAACGAGGTGCGTGGCGTGAACCGCGTCGTGTATGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGTGACCACGTGG
AATCCTCGCTTTGCCACCGCCCTTGCAGCACAGCATTGCAAGGTTATAGGATAGGCGCGGCGGAGGAAGACACACCAGTAACGTCAAGCTAATAGAGCAG
CGATACATGCATGTACACTAAACAAGATCAAATGAAGCAAAAGCGGCAGGCACGCTGCCCGTTGATTTCTCGGTAGAGAATTCTTAGCTTCAATTTGACT
GTAACGGCTGCGACTTCAATAAGCGGAGGAATTTGAAGACGCCACTGCAGAATGCGAGAGATTACTGCGTACAAAACACTGACTGTGCTTGGCAGTGGGC
AGTTCGGTAGTGTGGTGCTCGTTCGGCGAAACTCCGATAGAAAGCTCTTCGCGGCAAAACTTCCTCATGGCGAAGACGTTGCTGCAAGACAGGAAGCCCG
ACAGGAGACCCAGCTACTGACGCACTTGCAGCATGTGAACATTGTACAATTCGTCGAACTCGTTGAGGATGACTCGCAGTTGGCACTTGTGATGGAGTAC
GCTAGCGGTGGAGACCTGGACACGTTCTTGCGgtggcagcaagaagcacgtACGA