Description :
From Genome Similarity Track
Location :
Scaffold_5:230547- 231841
Transcript NameFunction/comments
Albla_Nc14008610conserved hypothetical protein
Albla_Nc14008620conserved hypothetical protein

Sequence
1294 bases(100 bases per row)
CTTTTGAAAGCTGACAGCGTCTCAGGTACAAAAAAATGTAAATAATCAAAATCAAATGAATTCAAGCAGCCGATCGATCACTAGCAAGCTTCCGCTGCTT
CCACGCTTTCCGATCTCTGTTGACCAAACAAGGACCTGAATAGCTCATCAATATCCATGCTCGGATTGGCGTGAGGCTCAGGAAACATAAAGTTTTCCAA
TTTTGGATGGACAACGTATCGAATCTGTCTTCCTTTGCTGGCTTTTCGATTTACAAGCTTTCTTTTCTTCCGATTGATACGAAGACGTAACGCAGCCTGC
CAGCCTCCAGCTTCGGTATTTTGGTCGATATACTCTTTCAGCAAATGCTGATAAAACTCGGCGTCGTCATACATGAGCTCATCCAATTCCAGCTCATTTC
CCTCCTTCACAATCGCGTCGTCTTTTGGAATGTGTGCCTTCCGCTTCACCCGCAAAGGATCCGCTATCACCGCATCCACTTGCGACAAGATATCTTGATG
GACAGCTTTGAACTTTTTCTCCTTCACCGCTTTTCCATTCATTAGCGCTGTCTTCTGAAGCGCAGCGCTCAGAATCGAATTGTATTCCGGAAGATTATTA
TCAATGGCTTTCATCGTTTCTTCCCACAGAGTTTCTGGAGTTTTACTTAGCGGAAGAGAAGGCGACTCTGAGTTCCAAGAACTTAGAATGGTTTCCAGCT
CATTCATTGTGTCGATGCACTCGTACAATGTATCGATACACTCTTTTGTGCGCTCTGAAGGCGCTTCATCTTCGTTTTGAATGCGTTTGAAAGACGATAA
AAGTCGTTTGGTGTGAATCTGATTCTCTAAACAGCTTTCCCAAATGAGCTTTTGGTTTCGTACGTGTGTTCCTTTCTCCAAAATGACTTCTTTCTCCTTT
TTAAAGAGATTTAAATTCTCTTCAAGTGGTTCATTATCAGCGATTGTATCTTGTGGCTCCTCCAGCTCCTTTGTTTCGGATTCTTCCGCATCCGTACTGC
TGCCAAAGCTCTCTGCGTCTGACCATTCCTGCAGTGCATCTTCGTCCGGAGAATCAGAGCATTTTTCATCGACATTACTGACACCTTTTCGTCTCACGAC
TTTGGCTGCATACTCTTTTTCGTCTTGTTCTGAGGGTATCCAATTGAGTTTACGGAGACGGGAGGGCTGTACGGTTGCGTTTTCACTACTGTCATACGCG
TCGTCTGTGTAAATGACACGCGCAGCGGTCTCATCGCCGTAATCATCGGTAGCATCGATGTCGAATGGATTTCCAGCCATTCTTTTTACAGATA