Description :
From Genome Similarity Track
Location :
Scaffold_496:2305- 16934
Transcript NameFunction/comments
Phyag_g6167hypothetical protein PHYSODRAFT_488619
Phyag_g6168hypothetical protein PHYSODRAFT_313188
Phyag_g6169conserved hypothetical protein
Phyag_g6170hypothetical protein PHYSODRAFT_313186
Phyag_g6171hypothetical protein PHYSODRAFT_492063
Phyag_g6172hypothetical protein PHYSODRAFT_492857
Phyag_g6173eukaryotic translation initiation factor 3 subunit, putative

Sequence
14629 bases(100 bases per row)
CGTCCATCTTGTTCCGTGGGGAATGCTCTGGAGGAGTGGaatcgtgctcttcttcttcttcaccctGTTGCCACTGTTGATTTTCCCCATGTGGACTCTG
CATGGCCTGTCGAAGCATGAGGTACACACAAAGTAAGTTCCTCGTCATCGGTAGTCAAGTCGCACAAACAGGCATTAATTATCACCAAGAGCTCCAGTGA
AACCGagtccacgtcctcctctcTCGCCACACACACTGGCAATTGATtatttgctggagctgacaTTCCAGTCGCAGGAAGGACTAGGTCGAGCTCCAAA
TCCAGCAATTCTTCCAGCGTCGGTCTGCGTGCATCTCTTGTCCTATTGCAGGTTGACTGAAGCTTTTCTGTTTTTTCGTCTCTGTCTGGActctgctgtt
gctgcagtttaAATAGTCGTTTGACGGGATCCAGAACGTGGATATCCTCCTGATTGCCATCGCGCTTCTTAATCAGCAAGCGGTTGGGAGGAATAGCCTT
GGTCatggcagcgtcgagttACCAATTGGTCGTTTCGTGTCTTTTGAAGATTTTTGCAATAAACCTGCAAAAAAATTATTATAGATAAATATTGCATTTA
CACATTGTAGCGATGGGGCTATTGAGTATCCTCAAGAAggtcaaggagaaggagaaggagatccgCGTGCTCATGCTGTACGCCACTGCCTATTGCGTCC
GTATCCAATGGACCCGTGAATTAACCGAGGAGCTGACGTTGTTCACCGCTCGAATTGGATTGTTAGGGGCTTGGACAACGCTGGTAAGACGACGATCCTC
AAGAAGTTTATGGGCCAGGACATCACCGAGATCTCACCCACGCTGGGCTTCGACATCCAGACGCTTGAACACAAGGAGTGAGTAGATGTGTCTATGTGTT
TGGGTGGGGATCTACGCTTTAATTTCATGCTGTTcgctcgtgttgctgctaccgtcagcttcaagttgaaTGTATGGGACGTCGGTGGCCAGCAGACAAT
TCGCTCGTACTGGAGGAACTACTTCGAACAGGTTCGAGCTaagatgttgctgttgacggACGGTGGGAATGGGCAAACGCTAACTATGTGTGATCCGATC
AACAGACGGATGGTCTCGTGTGGGTGGTGGATAGCGCCGACCGACGGAGACTCGAAAACTGCAAACAAGAGCTCGCCAATCTACTGACGCAGGAGGTTTG
TGCGTGTCATCGCTACATTGATTGTTGCTGTAACTAACTTTTGCTCGCTCGCTTGCCTGCTTCTGTAGAAATTAGCGGGTGCAACGCTGCTCATTTTTGC
CAACAAGCAGGACCTTCCTGGCGCTCTTTCATCTGCAGAAATCGCAGACGCGTTAGGTCTGCGGTCGACCCAGTTCTCCACCCGACACTGGAGCatcatc
tcctgcagcgctgTCACCGGCGATGGCCTTGTCGACGGAATCGATTGGCTCGTCGGCGACGTTGCCAGCCGCATCTTCCTAATGGAGTAGCGTGGATTGA
TGCTGTAAATGGCCTATCACTCGTCCCTAGTAGATATCCCTGCCGCTCGTGCTTCACgagcgttgaagttgccctgCTCTACCTCCATCTTTAATATCAA
CAATTCACCAATGTCGGATCCTCCGACAAGTCTTGTACATTCCGTGTTTGCTCAACatgtggcggtggtgatgctgtAAGTTAGCTTTAACGGTCATCGA
CTGATCGACTGATTCATTTCTGCAGTAGAACCTTCTCCCTCGGGATACGAGCCGCCACAATTACTCCGTCGTTCCAGAGTCCTTCATTGACTCTAAAGGC
TGAACCAGGTAGTGCATTGCTGAGTCGACGCTGTCTTGCTCTGAGAATCCTACGCCAGCAATGCTTCTTCGTATGTGCCTTTGTTCCTCCCCTGCATCCC
AGAACTCTGACTCGAGCGGCCTCCGCGTCTCTTTCTCCACCAAATGAAGCCCGCAACCAATACAATAGCCACAATACAACCCAGTACAATGGCTGTGATC
ATTCCTCCACTAACCGACGACAGGGATGTGAATGCCTCCAAAaacatgcttcgacttctcaaCTGCGAACTTGATGGTCAGCCTCACCCCGCTGCATACG
CGCGAtaactggaggagatgtgtcaagatccaagctcaagtgcctcTATGTGCCTCGATCGGGAAGTGAGAGGTAGCATGGAGGTAGCTCGTAAACTCGA
GCATTAACCAGGACTATGGGACCTTACGGTAGTTCATCTTTGAACGCCCTTCGGGGAATAAAGGGTTAATATCAAGTTCTACAGTTTTTGTCCAAAAGGG
AAATAACCAAAACTGGAAGCATCTTCGACATGGGACTGTCGGTGGAGAGCACGAGTccgccagcggcagctctGCCCGACGAGTccgccaacaccaacgt
gGCGTTCGACATGAGTGTACGTCTGTGGCGGGTGGAGGTCGCTCTCGCCGCACGGAAACTTCTGTCCCTGGGCCGCACCTACGAAGTTCATTATTCGCTG
CCCCGTGGCCCCattgatgagctgcagctagACGCCAATATCGGCCTCTCGGTGACCTCCATCCTGAATACTCACGTGTTCCAAGTGCAAAAGACGCAGC
CGTCGCAGTATCCGATGGAGTTCGTGGACAAAGTGGCGAGAAGGTCCTCCTCAGCCCTCAACCCCATCTACACCGTCGAAGCGGACGACTATTTGGTGGG
GATGGGGATGGAGGATTTCCTCCTCTGTCCACGGAAACTCAGACAACTCCACAAggacgtggctgctgcaggggcAGAGGTGAATATCAAGCAGGAGCAA
GACAAATCCgccaggacgaggacgctgGTGTTGCGTTTCGTGCGCATGGGAATGTCGGTGCTGGTTGATTCGACACAGGGCCGCACTCCTGGCCGCGTCC
TGCGTCttctggacgagatgaacaCGCACCACCAACAGCTAGTGACGCGCTACGCTCTGCTGATTAAACAGGACCGACTGGCGGTGCAGCGACTGAACTC
AGCCAAAAAGTTGTTAATGTATGTGAAGATTATGACTGGCGACACGAGGAACACTGTGATGGAAGACCGGACGTTCCAGTTTACTGACAAGTTTCGGAAG
TGGTATGCGAAGATTACGAGTGGGGAAGAGCAGAAGACTGTGTCTGTGAACAAGGATACCGTCAtggccgaggtggagcagcCAGTGGAGGACATGACGG
CCGATATAAGTCCTGAGCAACCTGAAAACGATAGCTACAGTAGCAACCCCACTGTCAGGTTTGGCACCAGGTTTGGGATTACGCCCATACTACGTCAGAC
AAGCTCGCTGGCCGGTCCGTCAACTGCGGCTTCGAAGAAAAGAGTAACGTTTGCTAAGGATATTACAACGGAGCAGTATCGTGTTGCTGAACGAAACGAA
GCTCCAGTCCCAACTCCAGCTGATGTTCCTCCCCAGCCTCAGCAGGGACAACAGAGTGAATCTTCTCCCAAGCCCAGGACCTACGGTGTTGACGAGGGTC
GATCGTATCTTCTCGCTTTGGTCGGCCCTAATGTCGACCTCGTGTCATCACTCCAAGAACTGACAACTGCTGCTAGAAATGTGCCGATATTGACTATGAG
CAAGGAGTTTCCCTTGGCTGCGGGACTTAAGGTGGGGTTCATGTTTATAGTGCTTTGCGCAGAGGTTATTTCGATTGACATTGTTTGCGCTCAGCTTCGG
CGGGAATTGTGGGAGGTTGGTCCCCCCAAAAAATATTGTGCTCGCGTCCGATTAGGGCATTTATCATTTGAAGACACGGCTTTGGTTGATCAAGTCGCTA
CTACTCGCGCGCTATCGCGGCTGACTAGTGCAGTGAGCGAACACCGAAGACTGTACCGTGACATGCTGTCGTTTTTGAAGGCTCAATTTGGTTTTTGCAC
AACCAACGATACCCGAAAAGTGAAGGACGCAGCTTTCAACTATCTGATTACAAAACGGATTGTGCGGGTACGTTTCTTTCCTTCTTGTTACACGACTTAA
AGAACTTAATGGGGGGTTGCTGTGCATAGCTCCGCGAGATGCCACTTGGAGAGCCTGATAACCTCATCTATGACGTGGTGGCGCACATTCAAGAATTTCC
TCTCGTTTGCCGACGCGGTTCATCTCTCCCTAGCACAAAAGGCGAGGTAGTCGACGCACTCATGCTGTTCTTGATGGAATTAATTGACCAATACGAGGAA
AGCCTGAAGCTCGACCACGCACAACTGATCAAAAGTGAAGTTGACCTTCACACGAGTGAGAATGCCCAGCTCCATCAATATAGCACACACGATTATGATG
ACGCGAACGAACACAATGAGGTGGACAGCATGCGCGACAGCAGTGAAACAATCGAAAATGGAAGCAAGAGGGACGCTGAGTTAAGATCTTTGGGTGTTCT
GCGGAAGCGACACTACGCGCCAAACGCAGAAGTAGATTATGAGGACGAACGTGGTGCTCCTCGTCCCCGCCTGTCGTATTCAGTCCTAGAATTACAAACG
CCGACATTACCCGAAACAACAGATACTGAAAGAGAAGACGACCGCATGTCTGCTGTGAACACTGCAAATCTGTTTGTCGAGGACAGAAGTGGCTTAGATC
CCAATCGTGATACCCCGTCTCGttcagaagatgaagacgcgaAGGCAAAATCGGACACGTATCAGGAGCTGTTGATGCTTCTTTTCCGAGATCGAGAGAA
GGTTGTTGGTGCCGTCAAAGCGATCGTGTGGAATCTGAGTGTCAGGTCTGAAATAATCAAGCTTTCGCCCAGTTTTACGGTACGGACTCATACACTTAAG
GATGCTGGGTATCACACGATTGTAATTGGCATGCTGATTGCGTACATTCTTGTAGGTCTCTCGGATCGCAATAAAACAAAATGACGGTCTTATAAGATGC
GTGCTGAGTGCATCTGAAGGCGTGGTTGAGGCTTGTGGGGAAGGACCAACTGTTGAAATTGCAAAGGATAAGGCGACTTCGATTTTGATTCATACACTAG
ACGGGATGATCCAGACGTGGAAGACACTGCTCGTTACCTACAATGACCGGCTTACTCAAACACCGACAACTTTAATGGCCGGGAACGAAACACAAGCGAA
AAATCATGACAAGGTAAGGTCGAGCATACTGATTATGTGGGATAACGGAAGGTTGATCGAATGAGATGTGGTTTACTGCATTACCTATATTTTGTTGTAG
GTGTCGGCATCAGAAAAACTTGTTCCACCGCTGTTCATGTATTTCATCAAGGTCCGCGGGGCACTTGCGATTTCGACGGCGTGTCTAAATGCGAAAGATG
CCAAGCGTTCTGCCAACGAAAAGTGGCGCGACACCCTGGAGTCTCTGAACAAGATGAAATCAGTTCCTTCATTATTATGCTCGAATGGAACTACCAATAC
ACCCAGTACTGCGTCAGTACCACGCTCTACAACGACCCGTGAATCACGTCCTCCGGTGGCAGCTCCAGTAGTAAAGCCCAACCTTATATTATGCAGTGAC
GATGAgatggatgacgatgacgatgattATTATTCGGATGGGGGGTTTGACGATGATGACTGGGATCCATCTGGGGTTAAAACGACCCAGGATACCCGCG
CTGTGGCAGAACAAACAGCAGCtttcgaagaagaactcaAAAAGGAATATGATGAACAGTCTGAAAGTGGCTACACCGATGATGCCAAATTCCGCGCCGC
GATTCGAAGTCTGTTTACCCCTACAGACGAGTTGTGTACTGGGATTAACAGACTCCGAGGGTCTCTAAAGTATCGAGGGGCTGAACATAGACCGATCGTT
CCCAATGTCACAGCGAATATCGGAATGGAACGCCTCCGGGAAGGCACTTTTGAAGTTCTTGTTGATGTCAATGGTGTCATTCGCTATAAATCATCTGAGC
GGGAGAAGCCGGATGCATGCGAAGCAGCCATCAATGGTATGCTAGCCAAGCTGAACAGGATTCGGTCGGTTTGggcgcagcttcttcactttctcGACGT
AAAATCTCTGGCGAATGTGTCACCCATAGACTCTTTCCGGGACCTGAAGCTATCAGGCATTGCCAAAGTAGGTAACGATCTTCTGGTGACTGTTGCTTTC
TACTACTAACTGTAGTCTTCGCTATTCATCAGATTATAACTACGGTGGAAGACCCACCTCGGACGTCGATTTCCCGAGATTCTCGctcagctgctggtgt
tcacTGTGCTGTGCGAGTGGATGACCATGTCTTGTGTCGGGCTACGTGGAAAACAGAAGCGGATGCTCGTCGCTTAGCTGAATGGCGGGCTGCGCAGTTT
TTTATTGATTTAATTGACTGTGGTCTTGATACGAAACCAcacgacggagaagatgaaaagatggagatcgaTGGTGAATTTCCAGCGGTCACAGACACCG
TTTCTTGGTCATGTCTTTTTCGAATTCAAGACGCGTCTGACACGAACAGCTTTCACGAATTTCCGGTGGATGCGTTTTGGTGCCGCACTCGCGACGGAAT
GGCACCCGAGCACTTTCCAGAAAGTCGAAACATCGTGGTGACTCAGCGTGGGACTGTTGGCATGGAAAGAATGGAGACAGAAGTGCGCAATCTTCACGAA
TCTGCGATGGCATTTTTCTGCTTGGAGTCCGCATACGATCACTGGAAGTTTGTGCGGCAACTTGTTCGCTACTCGGATAAACGAAAGCACAACTCGCGCG
TACTTGCGCTGACCATTTCGCCCGATTGTCCGTACAATATGTACGTGATTCCTCCAGGTGCTTCGATCAACAGTGAGCATAACTCATACTGGCCGGAGAA
AGCGCTTCCTCGCTTTGGTATTGATCGCAAGAGCGTGGTTGGGTTCTTGGCGAAGAAAAGAATCGGATGAAGTTCGTAAGAATACTGCAGGAACAGTTAC
TGTGGTGGATCGAAGTTTCTTTTACTTCCAGGCAGTGCACTTGTAATTGGTGATAACCTAAGTGGAGATGCACGTTATGTAATGCCCTAACattcgtcat
cttcgtcctccttgcCACTGTTATCCATGCCGTGGTGGTTACGGAAGACTGCGCTCTGTGTTTCAGCGTGGACCATCTCGAGATATTCGGCATTATGTAT
TTCAAATCTACGCTGCCGAATGATGTGTCCAAAGTCGCCAATAGTTCCACCGTCATTGAGGTCGTGGTCAAGGATCAAGTCCATGAGTACGTCACACATC
CGACGCACTTCAATGTTAGGAGCATCGGCAGCGAGAAGTAGGTCTGGCACAAAGCCGACACCAAAGAGGATCTCCTCAAACGTCTCTGGGTGCCTCAACA
TGCGGTAGAACGCATAGAGGATCTGCAATGTGAGCTCgttgtcgtgctgcttctcctggaACAGCGAGTGGAACGTGCGCACAAGCCGAGAAGACGACAG
AAGCGGAGCACTCTTTGGTTCCAGCGAGAGAGTGCTGACGAAAAGCACGACTTCAAGAATCATATCATCTTGCGAAAACCCCGGAACAAGTAGCTTATTG
AGGAACGGGATCAACGAGTGCTCTGTCATCAATTTGTCCCAAGAAGTCTTCGGAGGTAGATCACTCGGGGTCATATTTGCCAGTGTTGCCAAGACCTCGA
TGGAAAAGTCGTGGTTGTCCGTATTAAGGCACAGCTCGATGAATGGCGTCACGAAGGGGGCCCACATACCACGATACTTGTACGCCTTATCACTAACCAA
GTCTTCTTGGAGTGTGTACGACCAGAGCGAGATGTTTCGGATCACTTTCATTAGGAGAGGATCGCGCGTGCGGAAGACGCGTGTGGCCAGTGCTTCGAGG
CCGCGGCTTTGGCACATCAGCTCGGCGTTGCGCGCGTTGTGGCTGAGGTTCACAGCCAGAGCGGCAAGTTCCTTCGCCACAATGTTCTGCGGGAAGTTTA
TCACGAGCTGCATGACGATCGGAATTGCCTCCGTGTAAGTGAACATCGACTTGCATCGATCATCGATGCTGAGGTGGTAGAGAATTCGCAGTGACAGCGC
ACGAAAGGGTGGCTTCTTGAGTAGCTCCACAAGCTTTGGGATGAGACTATTCCGTACCAGTACGTCGCGAAGTGCCGAGTCGAATGACAAATTAAAAAGC
AGTTTGAGTGCAGTCTGGATTGTTTTGTCATGATTGCAGTTGAGGTATCGCACTAGCTTCTCCACAACCGTGAGCTCCACCATTGCATTCTTGTTCTCCT
CAAAAATGCTCAGTTTCTTCAGAAAGGTCATTGTGAGGATAACCAGCTCTGGGGCGACTCGATCCAGTAGCTACAGCAAAAAACCAAGAAACAGAACTTT
AGCTCGACATCTCACGGGAGATACAACTTAAATTAAAACAACAGACCTTCGTCAAGAACAGCACAATCTTGCGTTTGACCATTTTGCGCTCGGTGTGAAT
GTCCTCCGCCAAGTTGAGCAGCACACTAAAACACACATAGCTGCAGAAGCAATCGCAAGTGTCAGTTTGTTTCTAAACGCTGTAAAAGCATACAAACGGC
AGGGAGTCACTCTCTCCACTCACAGTAGCTGATCTTGTTTTTTCATGCGTTTtttgttgcgcttcttctcgcggtCAAGCTTCGTGAGAGAGTCATCATC
GCCCGTAGGTGCTTCATTGGCTGCAGTTTCCAGCAATTTCTCCTCTTCGAGGCGGAGCTGATGGCGCTTGAGCTCGAATTCGACGATCTTGAGTGTGATC
GCACCAATACGATAGTTGGCCATCATCGGatgcagctgaaggaagttggagaagcacCAGAAGATGCGCATCATGGTGAGAGAGAAGTCGTAGCTCTTCT
TGTagtcgtcgttcagcacgCGCGACAGCAGGCTCTACATAAATGGCAAAAAGACAGCGTTAGCTTCGTTCTGTCCACTTTCAACAGTTGTacagcaact
ccaccaaaCCATGAGCGCTTCATTCTGTACGAGCGCCTCGATGTTCCCGGCAAACTCGGCGAGTTGCAGAATCATCTTGGCCCCGTCCAGTTTGgactcg
acgtcgtcgtcgtagagCTTTTCCATGtacgcgtccagctcgtccgccTTAGCCGTGACCTTGCGGGgcttgtcgctcttgctgACAGCTGCATGGCTTG
GGCCACGGCTAGAACTTGTGCGGGAGCTGCTCATGACGCCTGCTACTTTGGGAAGTGAGCCCTGGAATTAGTTTCAACGTGGTTGGCCAATCAGCGGCGA
GGATCAGTTTGGCGCCAACAAAAGTCAACTCAAACGGAAATGGCGGGGTTGAGTTTCAGCCGATTGGCGTCATCGCTGCCAGTGCACAATTTGTCAAGTC
GGAACGATGGCTACATCACGACTGGTGCAGCGTACGGCTGCGTttgtggagcagcagctcaagagcaaCGACGCGTCTCACGACTGGCGCCACATCGAGC
GCGTGTGGGCGGTGGCGCGGACGttggcgacggaggaggcgcGTGCGATTGCCAGTACAGATGGAGCTGCTAGTCGCAGCTAATGCGGGTGtgtgtgttg
ctgctcctgttgttgttgttgttacaGCGCGTGCCTGAGGAGAAtctggagatcgtggacttggcggcgctgctgcatgacATCGACGACTGGAAGTATC
AGAGCGACAAGGAGAACCCCACGAAGCGTGCGGTGGCCTTCTTGCAGTCGGAGAGTGTGCCCAGCGACAAGATCGAACGCGTGATGGCCATCATCGACAG
TATGGGGTTCAAGGAGGAACTAGAAGGCAAGGGATCGGTACGGGatcgcgctgttgctgctggctgggtAATTTGTGGGTGTGGTGTTGACCAAACTTGA
TGATATTCATCGGCGAACTCGTTAGCGCTCGTATTCCGTTGAATACGGCTGCGTTCAGGATGCTGACCGATTGGTACACTGCCCTGTAAATGGACATATT
GGGAAGAATCGCATCGTTCTCATGCCGTCGAGATGTAGGATGCGATTGGTGCCATCGGAATCGCGCGCTGCTTCACGTATGGAGGACACAAGCTGCGACC
GCTGTATGACCTGAGCGTACCTCCAATTGACGGCATGACCAAAGAGCAGTACATGGACCCGAACCGGCCCAACACCACGATCAACCATTTCTACGAGGTA
TGGGTTTTGATGATTTTATGAGGTTGCTGACAACAATGTTGGATTCTGACATCATCTTGTGTCGGTCAATACAGAAACTCCTGAAGCTCCGTAGcatgat
gaagacggacgcTGGAAAGCGTCTGGCCGAAGAGCGTCACGCTTTCATGGAGTCGTTCCTGGATCAGTTCCACAAGGAGATTAGCGGCCGAGGATAGACC
TAATACAGCGCGCCATCATCCGCCTGCATTAGAAGGCAAGCAAACACATAGTTTCGCGTCGCAACTTTTACTTCCAACACTCATTAGTGTGCCTCGATGT
GTTTGCCCCTCTCTTTATCTTCTTTCCACGGCCTCCTTTATCCAGGAGGCCAGCCCAGCTTACGTCCTCCGAggaggtgcaggtgcagatGGAACACAGA
TTGACAGCCGTCCTCTCCGTCGTTGATGACGATGCGGAAGCCCTTGTCcaagttctgctgcttggcaacCACCTTGGCGGTGTACAGCAGGTGGCCCAGG
ATGGCTTCGTGGCGCTCCTCCGCGCACGCGAGCTGCGTGAGGCCGTCGCGGTTCTTGGGAATGAGCAGAATGTGCACGGGGGCCTGCGGGTTCACGTCGT
GGAAGGCCAGGCActgctcgtcctcgtacGCGATCTTGGCAGGGATCTGTCCGTTGAGTatcttgtcgaagatggTCTCGCccacggcggcggctgcgCC
CGTTGCGGCCGCGGCGTCGGCCTTGGAGCGTTCGTCGGAACTCATGGCGCGGCAGGTGAAGCGGGTGATCGATTGGCGCGACAGCGAGGATCTGGGCGCC
CCAAGTAGACTGCGGTGAAGAGCTCCGGTATGCATGTCAAATTTGGATTGTGTACCGCACACAACACACTTGGCAAGCTTGACATCAATAAGGCTTTGAT
GCATTTACTTGCAGCCTTTCCGAATTGAAGGAATTATCAACCAGCATTGTCATGCTGGTAGTTGGTCTTTATGCGTCCCTACTAACTTCCAGTATACCAG
CATAAATGGGCCAACTTCAATCCTCCGCTCCTAAATCCCGTCAAATCCGATCTAAGAGGGTCATGGTTTGCCACCACACATTGCAACGCACTTGCGCTCA
GATCGCAACCAGAgcccagcagcgcaagcACAGCAGAGGTCGTTAGATAAGCatgggcagcagcgacaccgtcgagccaacgcagcagcagcaggaagta
GAGGTcgcagcgctggaggagccGAGCTTCAGTTTGCTGGTGGCACCTCCGGCCGCCAAGAGCGCCTCGCCCGTGCGTCTGGAGAGCGTGAGTCCGTCGG
ACACCGTCATGGCGCTGCGCCAGCTCATCGCCGAGTTCCCGACGCTCGCCTGCTACACGTGCTACCACCTGGAGGTCAAGATCCTCTCGGACGCCACCTG
GCAGCCGCTCAACGACTTTGTGGAGCTCGGCGAGTGCGACAGCGTGGCGGACGGCGTCACACTGcgcatggtgctggacaagtacgacgCCCGCAAGGTG
CGCGCCCACGTCCGTCGCTTCCGAGACGTGCTGAGCAACCCGCCTATCCCCCAGGCCGCCACGGAGCCCGAAGCCCAGCCGGAAGCTGCCGACAAAGTGG
AGGAACCGGCTGAGGGCGAGGAGATGgaccagaagaagctcaaggagatcTCCGAGCAGCAACTTAAGCGTCTGCGCGAGATCCACCACAAACTCGAGGG
TATCGAAGTGCCTGTGGTGCCCGACCTGGCCGAGTTCTACTCCTTCCCGGGAGCTACCACCACCTCAcaggaggagacggagcagacggagacgcctgcc
aagggcaacaaggaccagaagaagaagaagaaaaaggacaagaagaaccagcagaagcaaaagcagcagcagaccgaGACCAACCAGCAGaaggaacaag
aagcgcaactGGACGCCAAACTCCCTGCCTGCGTTAagagcgtcgtcttctcggGCTACAACCCGCCCCCAGGACCACGCAAGCTGGCGGGTGATCTGTT
CTACCTGGAAGTGATCGTCGCTGGTGACAACACGCGCTACCACATCACGGCGCATGTCAACGGCTTCTTCGTGAACCGCTCGACGGCCACCAAGTTCGAC
CCGCGCCCCCACAAGACAGCTGCGGCCCATAGTCACCTGTTATTGGATGTTCTGAGCACGGTGTCGCCAAAGTTCCGAGAATCTTTCGCTGCACTCCTTT
CCAAGGCTGCTTCTCTGGCGAAGGAGGGACCTTCTTCGATCGAGTGGATGGTGGCTGCTGGTTCCAGCTTGGGTGGTAAGCTGCCGTGGAACACACctgc
cactgcagcgacggAGGAACACACGTACGACCTCAACCGCGCTGAGGATGAGCTTTGCGCGTCCTATGGTATGGATGAGCGTGGCGTACTGCGCGACTGG
AACGAGGAGTACCAATGCTGCCGCGAATTGCCGACAGATTCGATCAAGGACGAAATTGTGCGTGCTCGTGTCATGTACAAAATTGTGACGGAGTTTGTGG
AGGCTGCGACGCAGGGCGCTGTTGCTATCGTCGAGGGAAACGTTCCTCCTATTAACCCGATGGACGACAAGAGCTCTCATGTCTACGTCTTCAACaacat
cttcttctcggtgtCCATCGACGGCAAGTCTACCAAGGATGCGGGAGGCGAGGAAAATACTTTCTCAGCTGCCAACCGCGACCTGCAGGGTGTAAAGGCA
TTTAATGAGGCGGATGTAAAGGGTCTGCACACTCTGGCCACAACTGTCGTGGATTACCTTGGTGTACGCGTTATTGCCCAGAGCCTTATTCCTGGTATCC
TCATGGGAGACGCTTCCTCCAAGCTTGTGTACGGCTCGGTGGATCACGGCAAAACCATTGCTGCCAACGATAAGATGCACAAGCTCATGCTCAAGGCAGG
CGCGAAGTTGCACATCGCCGAGCGTAGCATTAAGCCTCTCGGTAagactgaagaagatctAGCGGctgagaaggagcaggaggcgcttAGCGGTACTCCT
GTGAACGGTGGTGAGGCCAGCACTAATGTGGCAACCATTTGCGGTGCCGTTGAGGCCAAGGGAATTCAGGGTTCTGATGGTCGTCTTTATGTCCTGGATC
TCGTCCGCATTACCCCAAAAGACTGGACCTTCTACAATAACCGTGAAGCCGCTCTGAAGAACGCAGAGGAGGGGAAGACCACTGCTTCTGAGGAAGACGG
ACTTTGTTTCATGCGCAACGATGAGGGTTATGTTGCTCTACTGCGCCCGGAGCTGGTACAGTTGTACTCGCTGTGGAAGCAAAACCAAGCCCGCCGCGCC
AACCGTGAGGCTCGCAAGGCAGCAAAGGAGGCAAAAAAGACGGAGCAGGAAAATGGCGTTGAGACTGACGCGGACAAAAAGGATGATGGTACAGCCGAGG
AAAAGGAAaccaaggagaacgagcaggaagaggaggaggaagagatccCACCGGTGTCGTTGAACACTAACGTCTTCATGGATTATGCAGCTTCTATTGA
TGTGGAGCAGCTTAAGGCTGACGAGACAGCCGTGAAGGATGCCGCTGAGTATCTGCAGAAGATTGTTGTACCAGCATTTGTTGCCGACGTGCGTCGTGGT
GCGATCGCCCCCGCTGATGGCTACGCTCTCACACAGCTGATGCACTCTTGCGGTATTAACATACGCTACCTGGGCCGTTTGGCCTCGCttgccaagaagc
tggagccTATTGGCGGCGTCTCCAAGTacctgctggaactgcttgagGTGGAGATGATTGCGCGCGTAACCAAGCACATCCTGGCTGATGTCTTGAACTC
CAACGACTCTATCCGTGCTGCACCAGGATCGGCAATTGTGAAACTCCTAAATGGCATTCTTGGATCGGCTGCGAGTGCTATGGACAAAACGGCTGCCTCG
GAGGTTAATGGTATTGATGATGCTGCTTCGATTACAACTGCTTCGTTGGATGCGAAGACGCTTTGGGCGCGCATTGCAAAGGAGATCAATGCCCGATTTG
ACTACAAGTTGGCTCTTTGGGGTGCTGATCGCGACGAATCTCGTGGCGAGGATGCTAGCTTCCCCATTGGGCGTGCGAACAAGACGGTCTTGCTGCGACG
GTTGTgccagcgtcttggtctccGCGTAGTGAGCCGGAACTACGAgttctcgttgtcgtcgccgaTCAGCCTGGATGACGTAACTGGCGTCGTGCCTGTC
GTAAAGAACTCTTTGCCTGCTCATCCGTTGACGCAGGCCAAACAGCTCCTTGAGCGTGGTCGTCTGCACTTAAGCCAGGGCGCCCTGTCGAGTGCATATG
AGTTCCTCCAGGAGGCATCATCGCTGCTTTTCCAGGTGTGCGGTGCAGCCCATGAGGATGCAGcactctgcagctcgtcgctcgCTACTGTGCTCTACCA
CGCTGGCGATGTTACTGGTGCTattgctcagcagcagcgagcgttGGCTTTGTATACCCAACTCCAGGGTATCGACTACCACGACACGGCCTATGCGCAC
GCGAACTTAGCATTGTTCCTGCACGCAAA