Description :
From Genome Similarity Track
Location :
Scaffold_25:23049- 26262
Transcript NameFunction/comments
Albla_Nc14028550conserved hypothetical protein

Sequence
3213 bases(100 bases per row)
CGATATATGGCATTGACGCTCATCCAAACAAGCAAATGTTTGCAACTGCAGGCGGAGGTGCTCATCGATACATTATCCCAATAAAATAAAATTGTGATTT
TATTAGATAACTGCGTCAAGCTTTGGTCACTAAGCCCATCGACTGTATCAACTCAGAAAGGGACTCCCATATCAGATTTTGAGCTTCTCGCAACACTCAG
CGATCATCAGCAGGCCGTAAATTGCGTTCGCTGGGCAAAACATGGGCACTATTTGGCTTCAGGCTCTGACGATCGATTGTTATTACTGTACAAAATGAAG
CCTGGAAACGCATCTTCCGTGGCTTTTGGGTCCAAACAAGCTGCCAACAAGCAGAATTGGGTCTGTTTTGCTACATTGAAAAGCCACACAATGGGTAACG
CAGTAAGAAGCTTTTAATTCTCCGCTACAAGAAGCTTACTTTGTATGTGAGAGCAGATGTCCAAGATGTCGCGTGGTCTCCAGACGATCGAATGCTCGCT
TCTTGCAGCATTGATAATACTATTCTGATATGGAACGTGGAACCCTCTTCTATCCAATCCATCATTTCCAGCCCAATTCGTACCTTATCAGCACACAATG
GATGGGTCAAAGGAATCGCTTGGGATCCAGTTGGAAAGTATCTATCGAGTGCCGGCGAAGATAAGACGGTTCGCTTGTGGAACACAGATTCCTGGGAGGT
TAAAAGCATTAAAATCTCAAGCACAATACCAAATCACATAATCTATTCGTAGGAGACGGAGGTCTTGTCCGAACCGTTTGAGTCATGTGCTTCCAGCTCC
CATTTTCGTCGAATTTGCTGGTCTCCGGATGGGTCTGTGCTATGTACTACACATGCATTTAGCTCCAAGCAAAATGTAGCTGCCTTATTCAATCGCACGA
CATGGGCAAACGAACTCAATTTGGTGGGGCATAAAGGTGTGGTGACCACGTGCCGTTTTAATCGCCAGCTTTTTCGAGCATGTCCGACAGAAATTGATCA
CGAGTACGCATGTTGTGCTGTCGGAAGCGATGACGCGACGATCAGCATATGGCTGGCGAAATTAGCGAGACCTCTTGTGGTAGTCACAGAGTGTTTTCAG
GCATGTGTCACGGATCTTAGTTGGTCTAACGATGGTTACATTCTGCTGGTTTCTTCGCTGGACGGAAGTATCTGCTGCTTTCAATTCAGTGAAAGTGAAA
TCGGAAAGCCTATTGCTGGAATCGAGCAGAGCAGGATTTTACAGACTCGAGTACGAATCAGCGCATCTATCTTATGTGCTTGCTCATATCTTGCCAGTAT
GGAGCCCATGTAGGTAACACGCAAACTAGCACGCTAATCGAAAACCCCATGCAACTTCAGGTAGTATCGCTGTTTGTGGGATCGATGAAAGCTGATGGAA
TGTGCAGATGGAAGAAGAACACAGTGATTCGTCGAAACAAAATGATAGTATTATCAGCCAAACGCCTACGCCGGAAACAAAGCCCCACGTCAATTTGTTG
CAGCCTGTTTCGAAGCGAACTAAAGTCGCCTTGAATCAAAGTAAATCCAGTCAATCTCAAGGCACTCTACATCAGTCGGTACCTCCAAGGGAGCCGAGAG
ATGCATCAGATACTACTGCAACTCAGATCTCACCATCAGAGCAAGTAGAACCAACAAATACGACCTCCACACCTTCCAAAAGCGTAATCTTAGAGAAAGA
TACTGTTCAAGTCGAGCAAAACATGGTGTCTACTATCTCACAACGAAAGCGAAATCGAAACGATAGCTCTATGAAGCGGAAGCAGATACAGAACTCGTCG
AAAGCAAGAGACATTCTTCCTCGATCATCCAAATGTGTCCCCGAATCGAGGTCTGATGCAATTTGTCTATTTACTACAAAATTTGATCATTTAATTCTCT
GTGAGATTCAGGACTGCACTCTTGTCGTCGATTCCATTACGCTTATCGTTTAGCGTTGACATATTTGCCGACAAATTGGATACTGGTTTCTTGTCGAGCG
AATCCAAACAACCCATTTTGAATATCGACATTACAGTTCACAATCTGAAGCGCGAAGACGATGACAACGTCATCGGTGCGTTTCTTCTGTAGCTCTTCTT
TCAATCAGTTTTGACTCACCAGCTTGTCCAGCATGCGGTCCAATATATACGACATTGCGTTGCTACCAAGAGAGTCAGACACTATGGATGGATCGCCTGC
CGGGTCGGGGGATATGTGGTACCGGAAATGCTTTCTTTTGTGCGTTTGGGCTGGATGGTGGTCAAGTATTTATTCTCAGTATTCGAGGGCAGCGTCTCTT
CCCCTGCATCAGTAACGAATACGAACCATTTGTTATCACTCTGCTGAAACTTCTTTAGCGATTGGTAGTGCAATTTCTGTCATGGAGTGCTCTCGCGGCA
ACTCGAATCATCTCCTGGTGATATCAACGAGTGGAATAGTTCATATCTGGAATATTCGAGCACGGAAGAAGCTCTTGACCGAATCGATTAACGCAATCAT
CGGAGTAAGCGATCCATCGATTTCTACGACCAGAGACTTTACTCAAAATATAGGGAGAGACCGGCTTCAAAGTGACACTATTGCGCTGTCAGGTAACAAC
ACGAGGCATGCCGATCCTGGCAGTCACCAAGAGTACACGGGACGGGAACGGACCCTCAAGCTTGGAGAATTACATCTTCGACAAAGATATGGCGAGCTGG
TTCGACTTTCTATGTGCATTGTGTTGAGGCTGACGTTTTTACTGATAGGATGCGGGTTACGGATACAAGCTTTATGTATTCTGATTTTAGCACATCGCTG
CCCACCAATGTCGTATCAGGCAATAGTGTGCCGGTATCAGCATCCCACTTAGCGAAAAGCATCGTATTTATTTCGGTGCTGTTAGATGCAAATACTTCGA
CAGCTACAGACAGCTTCAGGCTCTGCACGATCTCAACGGGGCATCCCATCAGCCATGCTAAGCGAGATGACTGATCCGTATTTACAGCGGAACCTTACGC
GCTCACATTTGGAGCATCAAATCGCAGCCTCTCGCGTGCTGGAAAGTCCGCAAGAGTACCAGTACTGGTATGGAACTTTTATGTTTCCCTGCAACTTAAT
GATTTTTTGTGGTCAGGCTGACAGCATATGCGAAATTCCTGGCGCAAGACGAAGATTTGAGTCGTTTGGATGAGCTTTGCACTGAACTACTGGGTCCAAT
TCATGAGTAAGTT