Description :
From Genome Similarity Track
Location :
Scaffold_58:230484- 237276
Sequence
6792 bases(100 bases per row)
TGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGC
AACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATAC
TACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTA
ACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGC
CGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGC
GTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGA
CGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAG
CCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTG
CCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCA
TCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGT
TCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAGCTCGCCTCACCTCTCCCAACGGATGGCGAGGTGG
CTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGG
CCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGG
AACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACT
GATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGA
AGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACC
CGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGA
CACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTTACTGTGACGGGCGAACAAACCGCAAGGT
TGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCC
TTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGT
GTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCT
ACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTC
CCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCTTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCA
GCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACC
TACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCAT
CGACCTTCCAAAGTCAATGACGACGCATTCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTT
GACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACC
GTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCC
GCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGT
GCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCC
AAGGCCAAGTGCAATCTCAAGCACGAGGAGGCGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGG
CTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAG
GAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACT
GCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCG
TACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCAC
GCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTC
ACAAGAACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTG
AAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCAT
AGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCCAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCC
TCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCA
TTCGAGAGCTCCCGGGGACTCAACGATAGCACCCTCCCTCTTCCTCTTCTTCCTCCCTTCTCCCTCCTCTTCATGCGAGGAGCCGAAGAGACTCTGATAG
GAGCGTCGAGTCTCCTTCTTCTCGCAGAGTGGAGACTTAGAGCCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAA
GACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGGCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCAC
AGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGATTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGTGCTGTGCCCTCCCACAGAGCCC
GCAGCATCATGAGTGCTCTCGGACTCGGCATCGTCTTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGAACGATTGTCTGAAGACGAGG
GCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGAGCAGA
GCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGACACGAGGCATGATA
ACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCCCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGG
TTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGAGGGAGGATGTAACGGGGTACGTAGC
CCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCA
AAACCAACCATTGGTTTTATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAAT
CTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCAGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTA
GCGCAAGGTGCTGTGTGACCCCGTCACACTTACCGAGCTGCAAACCGCTGGCACGTACGCATCAACACGCTCAATGCGCGCTCAGGAGATGATTTATCGG
CTAAATACTGCTCCAGCCAAGCCCCCTGCTCCATCTTCATATACTCGATCATGCCTCCAGTACACAAATACTATATATACAGGCTAGAATCTGCAATAAA
TAATATAACAAAGCAAATTTACCTCTTCATCCCGACGGACGTCTTTCATGAAGGTGACCAATTCGTGCTCAAATGTGATTTTAGTCTTTGCGCCTTGTCC
TTTTGTCGTTCTGCTAGTTTGAGGTCCCTTAAACTCAAACAGCAGCTTTGCCTTCTTTCTCCAGCCCTTCAACATACCTAATGGAATATTAAGCGCCCGA
GCGGTAGGCTTACATCCCTCCAAAGCCACCCGCTCGAACGCTTCCCGTCTCTGCTTGACGGTGTAGCTGTTCTGCCGACGACGTTCGTTCATCACTTCGC
AGAAACAGCAATAGCGTGATTGTTTAAACGGCGCCAGTATGGCGTGCTGTCCAGCAATATATTTGAAAGTATTATATTGGCTAAAATTACAAATAACATT
TTTACTTGAGTTTAAAGTTGCACTGTAAGGGGGGGTCGAATTTTTGTGGGGAGTTGAGTTTCACCGTCGTTGTCTGTACCATGATCACTGATACATGCAA
GCTTACATGTTTTGCATGTATCAGCGCTCCAACTTTATACAGTACCAGACTGGTGGTGGTGAATCACTGGTGATTGCTTGATCCCGTGCCGAGCACTTCA
AGAAGCAGCCGCGCTGAAAATTGTATCCGTTCGTAAACGATCTGTTAAGATCTACTTGTACTGTATAATGATTCTACGAGTACGCTGATTATCACTGCTG
CCACTACTAAGCTCATGATCGGTGCACGTGCCGAAGAAACGACCGAGCTGCTGCTATCTATAGCTGCTGCCGATGCCTCACTACCCTCGAATTCGCTGCC
AAGGGCGGGAAAGAGCAAGATCTGCACGGTGTTTGCAGGTATTACCACCGTCACTGCAAGCTCTTCGAGCTGCAGACTCACGCGAATTCTCTTCTCACTG
CTGTCACGGTTGGATAACACGAGGGCCAGTTGATTGTGTGGCGTTAAGAAAGCCACTCGATCCACCTTTTCCAACGTCGAATTAGCATTCCTGCTCACAT
TCAACTGGACTTGAAGTGATCCTGGGACGATAAACTTGGAAAAGTGGCCCATGACGTAATACATCGGTTGCTTGTAAAACTCAGCACCGCCTTTTTCATC
CACGAGAATCGGAGCGTCGACTTGGTTGTCTGCCCAGTTCGGGCCTCCACTTGTGTTGAGCACGAGGTCAGCCACTGGCGAAGCTGGCGAGGTCGTTGAT
GATGTCTCGCGAATAGTTCTCACCGCGCTGCCATGTGATGTTGTTATAGTCGAAAAGGTCGGTTCCCACTCCCGTTCCAAGGCCCTCGACCAGCGCGCCT
TCGCGCTTCAGTCGCTAGAATGAAGATGTCGGGATATTTCTCGTGGAAAGAAACCAAGTCGTCAAAATCTCCAGAAGTGCCAAAAGCAAAAT