Description :
From Genome Similarity Track
Location :
contig_55:230434- 231978
Transcript NameFunction/comments
g9287.t1hypothetical protein

Sequence
1544 bases(100 bases per row)
TCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGC
TCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCAGACCCAAGGGCCTCGAC
TATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATC
GCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGCTAAGAAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCA
ACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTACCTTCGTTAAGCAGTGCGTCCTGAAGCCCTCGGTACTG
ATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCG
CCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGT
TCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGATACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAG
AAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTG
TATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACT
GCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTG
CTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGA
CCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGC
CAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGACCGTAA
AGGGGGAAGACGAACCTTGTCTTCCAGACAGCAGCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGC
CGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCAC