Description :
From Genome Similarity Track
Location :
Scaffold_225:2304- 4578
Sequence
2274 bases(100 bases per row)
CGGAACGCGAGGGTGGGTGAGACCGTTTGCATAGAACGGAGTATAGCCTGTCGAGGCATGAACAGCGTTGTTCAACGCAAATTCAACAACGGGGAGCATG
GAGCTCCAGCGCATAGGAGTATCAGCGCAAACACTGCGCAAAATGTCATTAATGACGCGATTAACACGCTCAGTTTAACCATGGGTCTGAGGATGATCCA
CTGTGGACATGTCCAAACGGGTGCCGAGCATCTTGAAGATGGACTTCCAAAACTTGCCACTGAAGCGGGGATCTCTATCAGAGACGATTGACACTGGCAA
ACCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGCTTTACCTTCGGCATCAATAGAGTCCGGCACTGCCGCTAGGTGATCCATCTTGCTCAATCGG
TCAACAAAGACCACAATGCCTGTTTTGCCTTCCGAATCTTTCGTTAGGCCAAACACAAAGTCCATACTCATGGACTCCCAACACCCGGTGGGTACAGGCA
GACTATCCAGCGGCGCCGCCGCATGTGCTGAGGGTTTCACCCGTTGACACGTTTCACACGTACGCACATAGGTGCTCACCGACTTGTATAGTTTGGGCCA
CCAATAAGCCTGGCTCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGCCTCATAGAGTATTCGATACTTCAACTCC
TCATCATGAAGGACATCGATACGAGGGTTATCCTCAATATCTGTGCAATAGCACAACAGGCCATTATCGATAGAATATCGAGGTAGCCTCGCACGTAAAC
GTGCCGACAATTCTATGTCCGAGTCCTTAGACTCCTCGCTCCCAAGAGCAAGTAGCAAAGCTACACATTGTTCATCCGTGGCATAAGCCGCACGGATTAA
GTCAGTGACTGACGATGACAGTGTGGTTATGTGAGCAAGCTCATAGTCAGATCGGCGCGATAGCGCGTCAGCCAAAGCATTTTGCTTTCCTGGCTTATAC
TTCACTTCGAAGTTATATTCGGCAAAGAAGTAAAGCCAACGATCCATTCTCTGAGAGAGATGCGGCGACTGTTTCGCAGTGCGCAATTATGCATGATCTG
TATAGATCACAAATGGCTTTGAGCCAAGAAGATGTACTCCGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGAATAGTTCTT
TTCAGCAGCTTTGAGCTGTCGATATTCGAATTCAATGACGCGTTCGCGTCTATCCACATCTGTTTGTAAAAGAGCACTTCCTATGGCAAAGTCAGATGCA
TCACAGACGACGCTGAAAGGCCGATCAGGATCGGGCAAAGCCAGTATTGGCGCATGAAGGAGGCTTTCCTTAACTGCTTGAAAAGCCTCATGTTCGGTGT
TACCCCAACACCAATCCACATCCCTCTTAAGGAGATTGGATAATGGCCGAGCCATATCTACGTAATTCTCACTATACTTATGCAAGTAATTGGCAAGGCC
AAGCCACTTACGTAGATATTTTTGGTTCTTTGGAACCGGCCAATCGACTATGCCCTTATCTTAGCGGGGTCCACTCGAAGGCTTCAGTTCCCAATGAAGC
ACCCTAGAAAGGGAATCTTCTGCACCAAAGATGCACTTAGATGCATTTGCATACAATTTATTCGTGCGCATTCACTCGAGCACCGCTCGTAAATGATTAA
TTCGATTATCCACATCAGATCGACCGTTCGTTGCACGACTATGGACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGATGAGGTCTGAATAGTTG
CGTCACCAGACGATTAAAAGTAGCCGGGGCATTTGACAGCCCTTGTGGCATAACGAGCCACTCCCAGAGCATACCGCTCGGGGTACTAACCGCTGTTAGC
GGGATATCGCTTGCTCGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGAGCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAACATCCT
TGCTGGGGATTGGTGTATGAGCCGGGATAGTGGTAGCATTAAGCTTAATATAAGCGTGCACAATACGCCACTTACCATTAGGCTTTTTGACACAAAAAGT
AGGTGTGGAATGGGGAGACTTACTCTCCCGCACCATTCCCGCCGCGTTCTTAGCACGAAAGAAATCGTCAATGACTTCGCACTGTTCCATAGGTAAAGGC
CACTACCGTGTTACACAGTATTTCGTTCCTGGAACTAGTTCAACTTCATGACGTACACCTCTATCGGGAGGTAA