Description :
From Genome Similarity Track
Location :
Scaffold_2279:2304- 4083
Transcript NameFunction/comments
Phypl_g14905hypothetical protein PHYSODRAFT_326274

Sequence
1779 bases(100 bases per row)
CCGAGGAACGGCGCCGAAGCCTGAAGCAAAGTCGAGTAACCGCCAGACGCGCGAAGACAAGGAACCCCTCGACGTGAGTCTCACAAGAAGCACTCGCGCG
GACATGGGGCCCTTCAGACGCAGGCTCCGACCCGGAACCTAGCGATGGAAGCTCTAGCGATGGAGACTCCGACAGCTTGCCCGATGATGTCCCAGCGAAC
CAAGCGACGACCACTACGCAAGGCGGCACCACTGTAATGAGATTCCGGCCGTACGTGAACTCAAGTGCGCTGGAAGACTTCAACGACgaggcctcgctcg
ctgcgcgtcgtcgctggtgggAACGCTTCCTGAATATGACTGCTCAGGGTGGTTGGACCAACCAGATGAAGGCAtacgagctcaagctcaagatggcgcC
TGTTGTGCGCAATCGGCGCGgacagctcaagaaggacgttCGCCGAGATTGGGCCAAGCTATCTGGAGAGTTCAAGCTTGAATACCGCACGTCGAAGGTC
TCGAAGGAAGAACGGTACTACATCATGGCTTAGTTCAAGAATGAATCGTCTCTGGCGTTCCTGTACCGCATGAATCTGGCCGCGAGTCGGGCTGACGTCG
CGTACAGGAAGTCTGATCgacagcgcgagcagcacatcAAGAGggtcatcaagaagctcgtggatgaGCCGCTCCAGGTGACACTCCAGAGTCAGCGTTT
CCGCAAGGTTTCGGATTTGGAGTACGTCCTGAAGCGACAGGCAGAGATTCGCCAAGGTGACGGCAGAGCCGCCTGGACTCCCCAAGCACGCGATTTCCGA
GCCGACAATGTCATTCTGGATCGGTTCAAGCCGAAACGTGAGGACCGTGCGTACATTGCTCAAAGCGAAGGAGATTCCGAGTCTGAGGAGCGTGTCCATC
CCGAAGATGGTATGGAGGCGAATGGACCTGCGCTTGAACTAGTGGCCACTCCGGACGAACGCGGAGCGAGCACCCCGTATGTGGTgcgagatggagcagt
gATGACGAAGGAAGAACTCATTCACGAGGTCTACCGCGTGATGGAGAATTTAGGATGGCAGCCAAGGCGCCCGCAGCCTACTCCAGGAACGCTTGCTCCG
AGACAGCCCCAAGCATCGCCGTATCCATCTCACTTGCCGCGGAACAATCCGTGTCCCAACGAGTTCTGTGAAGGATGTGGCAAGTGGGGTCATCGTCCTG
ATAATTGCTGAGCCAACCTGATTTGTGATCGGTGTCATCGTCGTGGACACCCGACTCGCATCTGTGAGACGAAGCCCTGCAAGAAGTGTGACCAATTTCA
CGAATGACGTTGCGAAAACTGGAAGGCATTCCAAGAGATCAAGAAACTGATTCGCCAAGGGGGCCTGATTGACCTGCCAAGTCATATTCGGGATGCCTTC
CTGAATGGTGAGGCCGATTCTGAGGGAGCGCAGTTAAACCACTAAGACCGCCGAATGAGGATTCGGTACGCGTCGGGCTGAGAAAACCCTCAGAATTGTG
TGTCTTAGCGTATGTCGGCCCTGAATTGAGGACCAAGAACCAAGATAACAAACAATGCATGACTTCCCTGAATGATGATAGACCTGTGTCACCCGAGTTC
GAGACTTTGGACTATCCGGGACCGCCGTTACCTACAGCACCTGAAGGACCAGTTGAATTTCGACTGCAACCGGGAGAACGCTATGGGTGGTGGGCAGAAC
ACgatccagaagaagaaagacgTCAAGTTGCGATGGTTCATGGTGCAGTGAATAACGTCAGGATGCAGATCTTGCTGGA