Description :
From Genome Similarity Track
Location :
scaffold_1378:2304- 3381
Transcript NameFunction/comments
Pl_100773mitogen-activated protein kinase 1b

Sequence
1077 bases(100 bases per row)
CTCCCCATCTTGACTGCTCGGTGTGCTACTCCCATCAGCACTACTTGGAGTAACTGGACGGATATCAATGCCCCGTGCGAGTCCAAAATCGCAAAGCTTG
ACCAGACAGTCACGATTAATGAGCACATTCGACGGCTTGACGTCGCGATGAATAATATGCGCGGAGTGGACGTAACGCAATCCGCACAATAGTTGGTACG
TGATGAAAGCAATGTGATCACTCGACAGAGCTTCAGGCGAGTTAATTACTCGGTGCAAATCGGTCTCCATGAGGTCAGTTACAATGTACGTATCCTCGAA
ATGGGCGAGTGAAGGAGGACGCATTACGTCCAACACCGACACGACGTGTGGGTGTCGCAAATGCCTCATTAGTCGAATCTCTCGTACGATACGCTTTGCA
TCTACGAGATCGTCGAAGGTTCGTGGGATGTTCTTGATGGCCACCGAGTTTCCTGTGACTTGATCACTAGCAGCAATCACAACTCCATAAGCGCCATGGC
CTATCGCACGAATAAGTTGATATCTCCTATACACGCGAAACTTAGTTGAGGCCACTGTAAACGTGTACATTTCTTCCTCCTCAGATGAAGATTTCTTGTC
CTGCTTATCAACTCCATCAGCCTCTTCCAGCTCAAACCCGCCAGGAACATCACTCGCTGCAAGCGAAAATCGTTCGTGAACCCGCCGATTATGGCCAGTC
TCCTTGTGTAGCTCCTGTAGCCTGTCAAAACTCTTGCGGTACCTTGGCGTCCTTCCACCTTGGATTGGAGTACTTCCATCGGTCGATATGAATGACCGCT
CTCCGTCACTCATCATGTGCATATCGTCATCTTCGCCCATGGAATCATCATCATCTGTATACGGAGCGAAGCTTATGCTGAGCTCTAGCCGACCACAGCT
ATCATGATCCACTCCTCGTGCACTCTTTTCGAAAGTCTCAGCTCGATAAATATCAAACCACTTTGGTACAGCCACAGACGCGATCTGCTCATTTGTTCCC
TCCGACGAGCCCAAATAGTCCGCCAAGTTTACTTTGGCGCACCCGACAAGTTCATCACCAATGACACCAAGACTCCA