Description :
From Genome Similarity Track
Location :
Scaffold_47:23032- 25165
Sequence
2133 bases(100 bases per row)
CCCGTGCTGATGGTACGGGTGGAGACGACCGACATAAAACGTAGGATTCGTACGCATCCTGCGAGGCAACTCGATCGTGTACGCATTAACTTTGCGATGT
AGTACACGAAACGGGCCGATGTACTTGGGTAGTTGTTTAATACTACCCACATTATTTACTACTACGTGCTTAGGTAGATTTACCGTAGACAGTAGAACTA
AGTCTCCGACATTAAATAGAAGAACATTTGCTCTTCCATGTTTATCAGCGTTCCGTTTCTGTCGGTCCACCGAGTTAGCGATGGAGTCTTGCACGAAACG
GACCAATGCTTCTCGTGCCAGCAGAAAATTCTGCTGCATCACTTTGGTTTTTTGCAGTGCGCCTTGTGCGCACCGCTAGGAGGTTATCATCTTTTTCAGT
GATGGTGTTCTCATCCTCGCTGGTGTAGTCATTGACGATGCTAACTATACCAGAATCTTCATTCTCATCTGGGTCAGCAATAGTGTCGTCACTATTGCTG
AAATCATCAACTTCGATGTCGATTTGATCGACATCGGCAACGTTCGCGTTGTCGATTACCTCGACACGTGATGAGCAAGAGCCAGAACGGGTTTTGCTCG
AGCGAATCTCTCCCCCCTTGAATTAGTATCACACTCTAAATGGGTAGGTAGGCCTGGATGGAGTAAGACGTTCACGAAAAAATGTGTATGCGCTGTTGAT
GCACGCACAGAGTTGTTGATTGCAAACGCCACCACCGGCAAAAATTTGATCCAATCTGTGAAATATTGGACGTATCCTCGACGGATCTCTTCGAGGAGGC
GGTTGAAGCGTTCTTTCTGACCATCAGTCTCGGGATGGTCAGAAGTAGACATAGTCAGACGTGTTTTACAGGATCGGAACACGGATTGCCAAAACGCCAC
CATGAACCGAGGATCTTTATCAGAAACAAGTTTACGGGGTAGGCCGTGGAGTCGGAATACCGTGTCAATGAAGACACGGGCACGACCATGTGCTGAGATT
GACTCATTAACTGCAGCAAGATGTACCATCTTGCTGAATCGGTCTACGAACACAAGAATACTATTATTCTTGTGAGCGTCTTCGGGCAAACCGAAGACGA
CGTCCATTGAAACGGACTACCAGCACTCTGCTGGGATTGGTAGAGGCTGTAATGGCGCGCGGGGTGAAGTACTGGGCTTCACCCGTTGGCACACTTCACA
AGCACGAATGTACTTGCGCACAAACTGATACTGGCGGGGCCAGTAAAAGTCACGACTTACCGTGAGATAAGTCTACTCACGCCCACGATGCCCACTAGGT
GGTGCATCATGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN