Description :
From Genome Similarity Track
Location :
Scaffold_1876:2303- 3579
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1876-snap-gene-0.1Aspartyl protease family A01B

Sequence
1276 bases(100 bases per row)
GGAGTCCAAGTGTGGTACGTGCGCAGTATACTTTATGCGCGTTGGCTCACCATGTTGCTTATCTAATTGCTCATTTTGTGTGACGATCTGGTACAGGTGA
TGGAGCCCATAGTCCTGTTGCCGCGAGTCCTGGTGCTGGCGCGTCTGGCGCTACGACGCAAACGAGCGAGAATCCCGTGGATTCGCTTCACTACGGCACG
TTTTTCGTGCAGATCGTCGTGATCTCGGTGCTCGGCATCGTGCTCGTCGCGTTCGTGTGGCAGCGCATGAAGAAGCGCTCGTGGTACGCGGTCCCTGGCG
CCGATGCGCTCGGGACGCCCCAGGAAGGAGGCGATGACGACGACATCTTCAGTGAGGATGACGAGGACGCGCACGACCCGCCCGACTCAGCGACGAGCTC
AGCAGCGCGCGTGCGATCGCCGCCGCGACGACAGGTCCCGTCGCCCAAATTCACAATAGGCAGCGACGACGAGAACGAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAGTACATTTAGGAAAAAGCATTGCGCTTCAATGTACTG
ATATAGTAGAAGACGATCCAATACGAAACCCACCATACTCAGAGCTAGATGCATAAATAAGTAAATACAGTACACTTTGGAGGCTAATTAACTTAATTAA
TGACTTTGTGCTTAGGTTTCACTTTCATGTTACAAGTCACAATTCTGAAAATGGCATGTAGTGATGGTATGACGGCATCATCAAGAACGCGCGCGCTGCT
GGACGCAGCCGCCAACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACGTGAACGCGA
CACGCGGCGAGGGCTGGACGGCGCTTCTATACGCTGTATCGAAGAGCCACATTGCAGTCGCGGCGCAGCTCGTGACGCAACGCGGCATTGATCTGAACGC
GACGACAATGTGCGTTTAGCTTGCTTGTAGGCTTTTCTAAAGCGCAAATGCTACTGAATCGAACTAATTAGCGCGTATGTGTTGTATGCTAGCACGGGCT
CATCAGCGCTAGAGATGGCGCTCAAGCGGCAGCACAATGCGATGATCCGATTGCTGCTCACTCACGGCGCGTCCCGCTCTACCATCTGTACGTGTATAGC
TAGTGTATGCCTCCTTAATGGTCCGCTCCCATTGTACATGGGCGAATTAATTGAGTGGCATGGATGTCCAATAGCG