Description :
From Genome Similarity Track
Location :
contig_39:230265- 231267
Transcript NameFunction/comments
g6949.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
CGGAACAGCAGGCTACTGTGAGGTCGAAGATGAGGATTCCCACGAAAAGTTTCGTGTCATGAAGCGGACGTGTACGAGAGGCAAGCAGGCGGCCATTTTC
CAGTGCTCCGATGCTCCGGGATTCGCGAATTTCCACGTTGAAGCTGAATATGCCGTTGACAAAGTCCTCGCTCCGGAGTTCGCTCTTCCCAACGTGAATA
GCAGTCAGGGCTACCCGCGACAAGGAATTGCCATGGTGGTGTATCCCCAGCTAGTGGCTAGTGCGTATGCCACCATTCGAGCACTTCGAGAGGTCTTGAA
CTGCCAGCTACCGATTGAAATTTGGTTCCGTCCAGATGAAATGCGCAAATCTCCTGAAGGACTCGACCCACTCAAGAGTTTGACCAGTGACGGTATTGTG
GGAAACTTGACTTTCGAAAAGATTGACGACCCTCGAGCAGTGCGGTTCAACGCCAAAATCTACGCTATCTACCACAGCAAATTCGATCAAGTGCTGTTCC
TGGACGCAGACAATGTACCCGTAAGAGATCCAAGCTACCTTTTCGAGACGCCCGAGTTCGTAGAGACCGGTGCAGTGTTTTGGCCTGACTACTGGCACCC
GGGCAACACGATCTTTTTCGTCAACGCGAAATCGCTGGTTTGGCAGCTGCTCGGTACAGACTTTGTGGACATGTTCGAGCAAGAATCCGGTCAAGTTCTT
GTAGACCGACAGCGGCACGCGGCACCGCTCGAACTCGTAAGATTTTACGCTTATCACCGACCGAACTACTTCAATCGGCTAAAGCTCGCGTGGGGCGACA
AAGATCTTTTTCGCTTTGCGTGGCTAAAGCTTGGAGCTCCCTTCCACATGATCGAGGCACCACCTGCGGTAGCCGGCAAGATGTTTGGCAAGTCGTTCTG
CGGCATGACGATGGTACAGCACGACACCACAGGAGAAGTTCTCTTCCTGCACCGAAATCAACAGAAATTGTCTGGGAAGCCTAGTACTGACCAAGTCGAT
GG