Description :
From Genome Similarity Track
Location :
Scaffold_58:23025- 54677
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014103Similar to KATNAL1: Katanin p60 ATPase-containing subunit A-like 1 (Sorex araneus)
Pytul_DAOMBR144PYU1_G014102Similar to ydjA: Putative NAD(P)H nitroreductase ydjA (Escherichia coli O157:H7)
Pytul_DAOMBR144PYU1_G014101Protein of unknown function
Pytul_DAOMBR144PYU1_G014100Similar to hrq1: Putative ATP-dependent helicase hrq1 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G014099Similar to At1g43190: Polypyrimidine tract-binding protein homolog 3 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G014098Similar to CHAF1A: Chromatin assembly factor 1 subunit A (Homo sapiens)
Pytul_DAOMBR144PYU1_G014097Protein of unknown function
Pytul_DAOMBR144PYU1_G014096Protein of unknown function
Pytul_DAOMBR144PYU1_G014095Protein of unknown function

Sequence
31652 bases(100 bases per row)
TTGTTGTGTATGCTGCAGTTTCTTCGTGATATTCAGTACGAGTACGCTGCGATGGTCGAGTACCAGCAGATGCTGCACGACCTCAAGTTTGTTGCGAGCA
ACATGCAGACCACACAGCGGAGAACCAGATTACAAGATGAGACGAGAGCACGAAAGCAGCGACTGGGGCGATCAGAAGAGGAGAAGCGAGTAGTTCATTC
GAGTAAAACAGGCCAGCATGATGCCGGGGGCTGGAATAACAGCACTGCAGTGGACGACGACATGAATGGACCGGCTCAACGAGTAAGTCGCGGATGCAAT
ACTGGCATTGCCCTGTTTGCTGTGTAGACTAATGGAATGTGTTCTTTCATATGACATAGTGGGAGAAGCCGCGCGCTGCTGATCGACCATTGGCGAGACA
CTCGATGACGACTCGACAGGTCTCGACCAACAACATGATCTCCACTCGAGAAAGGAAGCTGCCGCCATGGGCGAACAAACGAGAAACGCAGAGCACGGAT
GTGATTTCGACTGCAATGTGCGTATTACAGTGCATGGCCGATATTTTTACTTTGCCGAAGAAACCAAAAAATTTGGTGCTAACTAGTTGCTGTGCTTCTT
TAGCTCCCGTTTCTCCAATCGAGCAGTACAACACCGCAAGCTACCAACAAGTACAAGGTCGTCCGCTGCCGTCAAGGGCAAAGGTTCGTTTATATGCGCA
TTTTATTAGCGGCTTTGATAATGTATCTCTCACGCCTTCCTTTGCCAATACGCTCAGAAAATGCCCACCGAAACAGCGTCAAGCGGACGACAACAACTGC
TTCCAAAGCCGCGGAACCAACTTCACGACGCACTTTGAGAGGAACCGACAAGGTGAGGCGGCGAGAAAGCGTTTTAAGCAGTGCAAGCTCTAGCCCAGAC
TCAAAACCCAATACAATAGCCGGCAAACAGAAATACTCGGATTTGGCGAAGGAGTATGGATGGGTCGACCAAGAGCTGATTGAAGCAATCGAGCGTGACA
TTGTCGACCAGGGCGAAAGAATCACATTTAACGACATCGCCGGCTTGGAGCACACGAAGCAACTTTTGCAAGAAACGGTCATGCTCCCCCAGATCGCACC
CCACCTTTTCGAGGTATTTCTTGCTGAAATTTGTATTACCAAGTGCTCCTTAGTTGCATTGTGGAATGCTGACGTCATCGTACTTGCTGAAGGATGGATT
GCTCAAACCATGCAACGGAGTCTTGATGTTTGGCCCACCAGGAACTGGAAAGACATTGTTAGCAAAGGTACGTTGCTAGACCTCCTATCTCAAGGCTAAG
CAAATGATCATCACTAACGAGTGAATTGTGTATGTTTGCAGGCGGTGTCACACGAATGCGGCGTGACATTTTTCAACGTGTCCGCTTCTACGCTGTCGTC
CAAGTATCGTGGCGATTCCGAGAAGATGGTGCGGATACTATTCGACATGGCACGATATTATGAACCATCGATCATCTTTATGGATGAGATCGATGCGATT
GCATCAGCGAGAGGAGCAGCAACTGAACACGAAGCAAGCAGAAGGTACTTTTTGCATTTCGAAGATATGTAACGGATTGCTTTGGCAAATGTGACATTGA
TATGGAATTTGTTTTTCAGGGTCAAAACGGAGCTCCTCGTCCAAATCAATGGCGTACCATCCATAGAACACGAAGGTGCACGCGTAATGCTGCTTGCAGC
GACAAATCTGCCATGGGAACTGGACGAAGCAATGCGCCGGCGGTTGACGAAGCGAGTGTACATCCCATTGCCTGAAGCTGACGCTCGCCGCGCGCTGTTT
CACCTGAACTTGAAGCGAGTCGAGCTAGCACCTGATGTTGACGTGGAAGAGTTGGTTCAAGAAACACAGGTATGGTCATGACCAATTACGCCATGGAATA
AACTTTCGGTCGCTTGAGAATAATTGCATTGCCTGGGGATTTGTAGGGCTACAGTGGCGATGATATCACAAGCGTGTGCGAAACAGGTATGCTTTCAGTT
CTTGCAGCCGTTTCTTTGTCGATGAGGTTGGCTTGTTCTTATATTAAGCTTGTGCACATTTCTTCAGCCAAGAGAATGCCAGTCAAGCGCGTCTACACGC
CAGGTTTGCTGATGGAGTTAAGTCGACAAGATCAAGAAGCTGGCGACGATCTCCGTGAACTGCTCGAGAAGAAGCGGCTGATTGTTACGAAGGTACGCGC
TCGTCCTATGAAAGTCGAGATGCAGTTGGGGTCTAATCGTCCGATAAATTGGTCTGATTGTAGGACGACTTTGGTGAAGCTCTTCGCAATGTGTCCAAAT
CAGTCGGGCAAGACCAGCTGCGTCGTTTTCAGGCATGGGAAACCGAGTTCGGGTCAAAGTAGAGAGCACACACAAAAGTAATGGTGAACCAGAGAATAAT
GACAAGCAAGTTTCGCATTTCCAAACTCAAAAACGACCACGAACTCCGTCACATGACATTGCACGAGCGTGCCATATGCGATTTTTTATCCAAGATGTAC
TCTAAACACTGAATGGGGTCGTCTACTTGGTGACCCATTGCACCTTGTCCTTGATGGACTTGCGCGCGCCGTGGGCCACGTGACCTGGCTTTGGGTATCC
GACGTAGAAGAGGCCAAGACACTTGTCCTTCTCACCGAGACCGAGGAACTCCTTCATTTCGTTCGAGAAAATCGGCGGACCCGAGCTCCAGTAGCCACCG
ACGCCGTGGCCAGCAGCCGAGAGGTGCAAGTTTTGCACAGCGCAGGCCGTGGCGCATACTTCCTCAATCTCCGGGAGCTTTTCGCTTTCCTGGCGCTTCA
TGCAGATCGCGATCACGTACGACGAGTCGAGCTTGGCCTCGATCTTCTTTTTGTACTTCTTTTCCATGAACATGTGCGGTGGCACCATCTTCTTGTACAG
ATCGGCCTCAAACTGGCCCAGGCGCTGGAGCGCCTCAGGCGTGCTGAACACGATGAAGCGCCATGGCTCGGTGCGCGCGTGTGTCGGCGCCCAGTTGGCG
CTCTCGAGTATCTTTTCCAGGATCTCCTTGGACACCTTGCGGCTCTTGTCGTAGTCCTGCGGGAAGATGGAGCGGCGGTGCTTGATCAGCTCGTCAGCGT
CCCACTTCTTGCCGTCGGAGAAGGTCGTGGTGGCGGGCTCCTTCGCGGCGACAGGCTTGGCACCAGCGCGCTGCTTGACCACGTAGAGCGCAACGGAGAC
GGTGGCGGCGACCGAGAGCAGCGTGATGGCGGGCGAGGGGGAGACCATTGTGCTTGCGGGGCTGTTGGAAGATTGGGGAATGGCCGAGTCTGCGACTGTG
ATTTGCGCCAAATGATTGCGGGATGGTATGGGATGATTATGGCTCATAGTTGATCTGATTGGCTGAAATCGGAGTAGACGAACAGGATTGGGCAATTCCT
CGTGCCTTTTTCTCCAGCTAGTGTCTCTGTTTTATCTGAAGCGGACTTGCACATCATCCCGGGGCCGACTGCTCGACAGTTGCTGTGACGCGCTTGGCGT
TTGCGGACGAGACTTGAGGTATGTGGACGTCGTGAAGCCATTGCGACTTTGGTTTTGAAGCAAAAGTATCTTCACGCGACGCGATTTGATTGGCTCAATG
CCACGTCACGATGTTTTTCGAAGGTGAGGTATATTTAAGTACAATTTAATGACCTAGAGAGAGAAGGTCATTCTATTTAACTTATTATCTACATATAGTT
TAAGAATTCCAGTCTCATTAACACTGCTGAGAGTGAGGTGTTTCTAAGTTTTGACGGTGTGGCACCGACGTCATTTTCGAGTAGATCTGCGACTTGGGCG
TCACGATGTTTTTCATTGATGATTGATTCATCGCTCCATACTGTACAACGTCAACGCAACTATCGAATCGTGTGAATACAATTCATTCTTTTCCCACTTA
GTGACCATCCTGGACGATGGTGAATTGCAACATTCTTTCTTACGTGATGTGGTTCACGTACACTTCGGTTAACAGCCACACTGCGGTGGTGCTTTTGTGG
GTCCATGGTTCCATCAGCGCGAGAAAGACCACCATTTTAAACGACCACGATGACCGCAGATGGCAAGAAAGCACAGCCAAACGTGCTGGCGCAGCTCGTG
CGCGACTTGAAAAAAAAAAGACGAGTTTGTGCTGCGTTCAAAACTATCCTGGTGTCTCGTGAATCAGCACGTGAAAAAGCACGGCCCGCTTGTGAACCCG
AGTTTTGGCGAGTAGCCTGCGTTCTACATTGATGAAGGCTACTTCACGCCGTATCGGATGGTAGTGTGTGGCAATGAGAAGGTAGCGGCCAAGATTGCAA
GTCTACTGGGCGATTGGGCAAGATGGTCTGGAGAAGGAGGAAGCGTGACAACTTCGCAAGAAGCTTTCGTTCTTGAACAGCGTTCCAGAAACCGACAGTC
AGAATACTCGATGTCGCTTACACACCGCAAGATGCTGACAGAGACCTGTCGACTCAGCAAACGTGGACATATCGAGAACCTTTTATTGTTGAGATTGCCA
AAATCTCTGGTCAAGGCTCCCAACGCAGTGCACTCGATCGTAAAATCCGCAACGAATACTTCCAGCATGGTGCCCAGTTGGGTTGGTTAATCGATCCACG
TCCAGATTGCCACAAGATGTACGAGTACAAGCTCGACGACGATGGACAAGTGTATTGCGTGAACTGTGACACGTGGAGAGATCTCGATTGTGGTACCGTT
CTTCCAGGATTCACTCTTGCCAAAACTGATTTGGACATGGTTCTGCGCCAGATTGCTGGATCGTTGTCGGACGAGGAAGTCGATTATGTTTGCCCAAGAT
GCCAAAAACGATTGCAGTCACTCAATGCGTGGGCTGGTCATGGTGAGTGGCACCGCGCTGAGCGCGCTCGACAGAAGCATAAAGAGAAACAGTAATGGTT
CAACACAAGCGTTCGCTTTATTGATTCATTTAAATCTGCAATCGAATAATGAATGGCATGCGATAGATTCGGTTGTTGGTGCTTGGCTGCTTGGTGCTTG
GCTACTTGCAAACACTTCAACCAGAGCTGTTAGATTTTTGCGCCAATGGTAGGTCTCCAATGCGTCCACGTTTGTTTTTTTCCAATGAAGTGAGTGCACA
CAAGCACCATTCCAGCCAATCAAATGATCACGTTGGGATCTCCTTCTTTCCTTTCTCGCAGGTCGTCAGGAAACGCCATTTTCATTCGAAGCGCCTCCAG
ATGACGGCTCGAAACTCGCGCGCTTTCCGCTCAAGCAGCGCGCGCGTCATTCGGCAACCACCGCCCGCGAACGAGTCGCAGACCCGAGCGCCGCGCTTCC
TCCCTCCCGCAGACCAACCCCACAGCAAAAGGTGCGTCTGCCGCATGCGAGTATGTATGTGTATGAAATTGAGATAGAGAGCGAGCGAACACTAATGGCT
ACTTCGTTTTGCGAATGCTGCAGATCATGAACACGACCACTTCGACCAGCAACGTGCGCAAGCTCACCGGCTTTTTTGAGCGCGCGAGCAGTTCCGAACA
AGCGAAGGCCGGTTCACCCCGTGTCGTTGTTTCGGGCGCCGAAGACAACGTGGATGCCCTGATCGCATTTTTCGGGCGAGTTGCCACCATCACCGTCACC
ATTACTACCACTAGCAGCAACAGCAACGGCCTGATGAAGGCGAAGCCGCGGTCGCTCTCAATCGCCTCGACGGTGTCCATGTCGTCTTCTGAGGACCATG
ACGAAGACCACGACGAAGAAGCCAACGAAGAAGCCGAAGCGCAAGACCCTGTGAATGCGAAACCTACAGCTGAAGCGGAACTTCGAGTCGAATTGGAAGT
TCCTGCCCACGCGGGAGCTTTGGTCGACAGCGACAGACGCTCGCTGCTCCGCCGTGGACAGCGCCAACGCGATGACGCGTTGCCTTACTACTTGCAGTTC
GCGACGTCGCGGCCCTACCTCCAGCGACTCGAAGAGAGCCTCGCTATCCGCAAGCGCATCGGAAACCTGACGCCACCGGTAGCAGCAAGAACGACTTTGG
CGAGGACGATGACTTTGGCGAGCAGCGATCGCAGCACCTCGTCGACCGCAACCAAGACAGAGCAACCGTGCCACCACCAACAGCAGCAACAGCAATGCCC
CAAGCTGACGACCAAGCCAGGTATGAGCGACGAAAAAAATTTGACCAGCACGACCGCCACGATAGCAGTCTGCTTCCTTCTTTGTTCAAGGCAGAAGTAA
ACACGCTGTGATTGAATTTATTGGTAAGCCTTATTTTTTTTGTATTATTTTATTACGAGTACGCCCACAAGCAATTTTCTTAGAAATTAACCTCACAATA
GACACAGAAACATGTGCAACGACCGCGTCGTTTGCTTATTTGTTGTTGTCGCCGGATCCAAACGACGTTCACATAGATCCGTCCGTTGTCATGCTAGAGA
ACTACGAGAGCATCGGATTCCCAATTCGAATTCTGATGTTCAGGCGAATGCAGTCTTTCGCGCTCACTGACCATGGATGGGTGGCCAGAAAAAAAGTGGC
GCAACAGAAAAAACAAAACATTGTGATATGGGGAATACGCGCATTCCATCTGCTCACTCCGTTGCTCGTTGCTTAGTGGGCGAGTCTTGAGCCGTATGCC
TCATGGCGCTTGAAGCGTGCTGCTGCTTGCGCGGACTGAAAAGCTTTCTGGGTATTGACGCAAAGGAAAGGGACGCAAGGGACTAATATGGCTACATGTT
TGACAATAATGATCGAGCCAATCGTTCAAGGCACGAGCGACAAACTCATGAATTTGCGGACGCAGAGACGACCTCCAGTGTGTGATTTGCGAGCTCGTTT
TGATCTCTGTTCTCTGTTTGAACTGCCACTGCGAGCTGCGCACTAACCAAAGACTTCTCCTTGACGAAGGCGCCATGGAGATACTCCAAGACCAGCAGCG
ATCCGCGCTTATCGAGCACGTTGTTGTACTCGGAGCATTCTCCCGAGTGGATGCACGCAGGGCATCCGCTGGCACACGCACACTCGTCGGCGATTGTCCA
GGCTTTCGCAATCACCTGGACAAGAAAAAAAAGAGATTTTAGCGGTACATGCTGCTTAATATCACGTGACAAGAATGCGATCGCACGCACCTCAGGAAGC
ACCTTCATGATCTCTTCAATGATGCCGCTGCCGCCCTCACGTCGCTCGTAGATTGTTATCCGATTGGGTCTGACAGCCAAAACCCAAGATATCAGCGCTG
TGTCGCGCATTCATATGACCACATGACTCCACAAAGCCACTTACCGCGTGCGTCGCTCAAAGGGGTTGTAGTGCTCTGTGTTGACGTCGGCGCCTTCACA
CAATACAAACAGCGGGATGACAGCGATGCAGAGATGGCCGACACCGTGCAACGCGCCACTCCAGCTCATTCCCATTGCCTCAACTTTTTCTTTCACCGTG
TTGGGGAGCTCAAGCCACAGGGCATTTCCAAACGACTGCATCGGCGGCAGCGAAAACTCGTTCGTATGAAGGTGGCGCATGGTGCGTTTCTCGAGCATCG
TCGACCCAAACACCATGGTGAGCACCGAGACGACGCCAGTATGCAGAAAGAGCTGCGCGTCACCACTGATTCGTCGCTTCGACTGGATGCGAACGACGTC
GATTTCCGTGTAATCGCGACAAGTGGTAAAGTATTTCAGCTCAGTAGTGCACTTTTTGGCGTATGCAACCTTGTTCTCAACATCCAACCTCGCGACGAGA
TACTCTTGCGCTTGATGCAGGTACACTGCTGTTGGGTACACCTGGAAGAACACGCGCTCACCTGGGATCTCATCGAGCACCGTTTGCTCCGCATCGTCAG
TGACAACCTACGTCCAACAGCAAGGAAAAGTCAGTCACGCATAAACTAAGGCGCCTCTTCGCATGTTCAAACACATAGCGTACCTTGTAAACGATTTCCG
AAATACTTCTCAGGTTGACGGCGCGAAACCGTTTAGGAATGCACGAGTGCAGGCGGTAGCCACCACCGTCGCCATCACCACAATGCACCAGCTTTTGGTC
ATGAACTAGATCTTTTAGGATTTCCTTCAACGGTGTTGATTCTGGCTGGCTGATGTCTCCAAGAACGAACGAATCAATATAGTCTGTTTCGGATCGATTC
GAGTACAATGCCGACTCTCGTGCAGCACAGAGGAGGTGCTGGCTGAGAACTTTGACATTTGCTGGATTCAGCGCCACGGCTTCGGGTCGCAACTGGAACA
GATCTGGCGCATGCCGTGCGAAATGCTGATCGAGGGGAGAGTCAAAGCAAATGATCACGGCCACCGACTGCTGTGTGTGTTTCCGCCCCGCGCGCCCCGC
TTGCTGCCACAGAGACGCAATGCTCGTAGGCAGTCCGAGATGCATTGTGCAGTCCAACTCACCAATGTCGATCCCCAGTTCCAACGCATTCGTCGCAACC
ACTCCCAGAAGCTCCCCACTGAACAATCTCCTTTCAATGGATCGCCTGTCGTCCAGCGTGTACCCACCTCGATACGAACTCACGCGCTTCAGGAGATGGC
GGTTGCGTTTATCTTCGCGCAAGATCGAGTGTACACTCATCAACACCATCTCCGCCAACTTCCGGCCCCGGCAAAACAGGATCGTGTGCACTTCGTCTTC
CATTAAGCGTGCGAATATCTTGGCACTTTGAAAGATAGAGCTCGTGCTGATCCGATCCGATTCCTCTGCTAATATCGTGACGTCTATGGGTGTGTCTCGA
GTTTGCAGCTGTGATTTTGAAGAAGTGGCCGCTGTATCACGTTTGCGTTTCTTGACGGAATTTGGTGGCTTCTGTTTGCTGGTACTCTCATTGGCAGTAG
TAGCATCATCAACCTTGGGGTTCCACAAGCAAAAGAACTTTTCTCCCGTCGGTGAGCCATCCTTCGTGATCACGAGCAGTTCACGCTCTCGAAACAAATG
CAGACTCGCTGGCGATTTGTCTTCCTCGTCGTCTGAAAACGATGATGTGGACGGAGGAGGTGGAAGTCTGGGAAGAAGCAATCGGAAATGCTCGGTCGGG
TTTTGAATTGTTGCAGAACAACAGACGACTTGAGGATTGGCGCCATACAGCGCACAAAGTCGAAACAACCGCTTAAACACGCACGCCACATGCGAGCCGA
AGACACCGCGATACATGTGCGCTTCGTCCACGACGAGTAGCCTATGCCGGGCAAGTGTATAAGCCAAAACGTCAGTGACTTTATACAAAATTCTCATTCT
TCATCTACACGCACTTTAGCTTTGCGAGCACGCGTCTCCACTCGGTGTGTCGCGGCAGGATCGTGAGGTGCAGCATATCTGGATTCGTGAGAAAAATTTG
CGTGTCTCGGATCACCATCGATCGGGTCTTCATCGCCGTGTCACCATCCTGCCATGACAGCAATAAGGTACAAGAACAGGAGTCTAATGAGAAAAAAAAA
CGCGACTCGCTTTTGGAGTCAATGCCATGTTTGAGGCAAGCAGACGTACGAAAGTCGAGCAGATGTGTTGCGGAAGCTCGGCAGCCGCTAGAAAGTTCCG
CAATGACTTCAGCTGATCTTGAGCCAGCGCCTGCAGGATATACACACGTAACACACTGTACGTGAGTGTGCTTCGCCAGCTGAGGTGATGAGCAACAGAC
ACGAAGAACTCACTTACTTTGGTAGGGAATAAATAGAGAAACGTCGAGTCCCCGGCTTCGAGTATGGACGCGAGCATCGGGATGTTGTACGCGAGCGATT
TCCCGCTCGCCGTGGACGTGGAGAGCACGACATTCTTGCCGTTGCGAACGGCCTTGATGGCGTCAAACTGGTGCGAGTACAGTTGGCGAATGTTGCACTT
TGCGAGCGCGGCGGCCACACGAGGCGGCAACTCCAGGTCCGCGATGCTCCGGTACTTGGCATCGCGAGCGGGGCGACGCTCGATGTGCACGATCTGGTTC
TTGTAGATGTTCAGACCCTGCAGCATGCGGATCCATCGCGAGTACACTTCGCTATCGCTGATCGTATGGAAATCTGCTGCTGAAACGGATGCTGGATTGT
CATTATGGGTCGAAGTGGCGATAAGGACGGCGCCATCAGTCGCTTGGGGTGCGCGCGACTGTGATAGCGACTCTTCTGGCGGTGTCTGCACAGCACTTTT
CTCGAGGGCGTCTTGGAAGAGCTTCTTGCGCTTTGCACTCGCACGCTGACTCGCCTGTGACGCACATGGGAACGCAACCATCTCCTTCTCATGCTGCGTC
ATCGCCGTCGCGCGAAACACGTCATCTAAAGCACGCATTGCATGTAATACATCAGCGTCATATACCATATCGACATCATGGATGCCGAAAGGCTATAGCT
CATAACGAAGCCACGCACCTTTGTGCTGCGCCTGCTTGCTCTGGGAGGCGTCGATGGCAATGACGTGGGGCGCCACGCGCGCCATTTCGTGCAGGTCCGA
GACCGTGAGCGGCGCGCCGCCGAGGCTGTTGGCCATGTTCACCACGTTCTTCACGCTCACGACGGCCTTGTGCTTCGTTAGGAAGCCGAATGCCACATCC
ACGCGCACGAACTTGCTCAGGAGCAGCGCATTCTCGCCATTTAGCGCCATTTTGGCTTGCTTGCTACTCAATAATGGCTTCTCGCCTGTTGATGTTCCAG
ATGATCATGTGGAACAGCATGTAGAGCGCTCCGCACAACTGGATTCATGCCAGAGCGTTGCACCATGCATGCGTCAAGGTACCCTTTTCAACTCCCACAA
TCCATGGATGAAACCCAGATACTGTCTTCTAGTAACCTCAATTTTCGATATTTGTATTTACTTTATATATATCATAATCGAAAGGTAAGTATTGATTGAA
GGTTGTCTTGAAGTGATGTATCTTGTTGCTGCACAAAGTACGAATTTCGCGCACACATGCGTGCGCCATGTTGGCGACAGAGCAGAGCGGCGGCGCTCGT
CACTCTCTCTCTCGCCTCCATCGACGCCCTTCAGCTGCACCCGCCCCCTCTCTTCCTGCATGACGACGTCCAAGGTGCTCTACTTCGACCAGCTGCCGCC
GCACTGGACCGCGCGCGACCTCGCGGAGGCGCTCGCGCCGTTAGCGGAGGCGCCGCAGATCACGCGCTCTGTGTTCCTGCACAAGCGCAACGCGCTCTAC
GCGGGCTTCCACCCGAGCTCGCACGAGATCATCCCGAGCGCGCCGATCCCCGCGCTCGCCGAGATCGTCGATCTGGACACCGCCGTGCGTCTGATGGAGA
CGCTGACTGCGACGCCGTTGACTATCGACCATGCGGACGGCACGAGCGCCGTCGTGGCTGTGAGCTACTCGAAGAACCAGGAGCTCCATGACCGCATCCC
ACCGCCGTCGGGACACGGGCGCCACCGCCGCAATCACGCGGATATCAACAAGGCGAACCGCATCTTGCTCGTCACGGTGCAAAATCCGACGTACCCGATC
ACGACCGAGCTGATGCACGGCATCTTCAAAGGCTACGGCGCCGTGGAAAAGATCGTGATCTTTGTCAAGCCCATTGGCCTACAGGTACTGAGTCTTGCGT
ACTCTAATCTTTTTTTCGCATTATACTGATCGGATGTCTGTGCTGGTGGTGCATAGTGCTTGATTCAATTTGCGACGATCGAAGAAGCGACGCACGCAAA
AGACGCGCTCTCTGGCCTCAACATCTTTCCAGATTGCTGTGGTCTTCAGATCAATTTTTCTAATCTCCCGGTGCGTTTCTTCTATCATTTCGTTGCGTTT
GGTGATCAGCTCTGATGTGAATCGTTTGTTTCTGTTTCTAACTACGTAGCAAGAATTGATCGTGAAGGAAAATGGTCTGCGAACGCGCGACTTCACGAAC
CCGGACCTTCCTGCGGCCAGCGACGGTCGTGACACTGCTGCGAGTCCAGTGGCCGATCTCGATATCTTCGGACAGTCGCTGCCAGCAGGTGTGATGCCTG
CGATCGCTGTGTCTGGACGCGACGCCGTCGTGTCGCCTGTTCTCCTCGTGTGCAGCCTTCGCGAGAAAGTGACGTGCGATAACTTATTCAATTTATTCTC
CTGCTACGGCAACGTGGTCCGCGTCAAGAAACTGAGCGCCAAGCCGGTATGGCCCTTACTTTGGAGGTTGAAGTTATCGAAAGGCAATCAGCAGCTAACA
GAGTGTGTACATGTGCCACCAGGACCATGCGCTCGTGCAATTTTTGAATCCGCTGGCGGCGCAGTCGGCGCTGATCCACCTGCGCGGGTACACGCTGCTC
GGCAAGTCGATGGAGATCAGTTTCTCCAAGTACATGTACATCTCGAACCGCGCAGGCTCGACCGAAAAGTACGTACATGGCGGCATTTTGTGTTGCAGCT
CCTGACGCCAATATGCTGCAGTTTGGTCTTATTTGTGTCTCTATTATGTGTACCCCGCGCAGCCCACTCGTGAAAGAGTACAACCACTTGCCGAACCGGT
TCACGGGGAAAGCTGCGATGAGTCTCGGCAAGCACGTCTACAGCCCCACGAAGCTCCTGCATCTCTCCAACTTTGACGAATCCACGGCAATCGAGGTGCG
GTGCCCGCAGATTTCATGTATGCAATGAAACGCTCATGGTGTGAACATACCTGGCGTGTGTCTGCGGTTGCTTTGCTCATGTGTAGATGCTGAAGACGCA
CCTCGGCGGGTTCCACGGCGGCGACCATTGCAAGGTCAAGACGTTTATGAGCCCCAGCGGCCACCTGCAGGCGCTGGCCGAGTTCGCGTCGGTCGACACG
GCGACGAACGTACTCGCACAGGCGCACAACTCGCTTCTGGGCGCCAAGCCACTGAAATTCGCATTCTCCAATCGCTCGTTCCATTGAGAGAGAAAAAAAG
AGAGTCTGCAGTACATATGTCTCTATCATCTATACACTAGTGTCGTTTATAGCAAGCATCTTTTGTGTCGCCTAAACTCGTCTATAACAAATATCACGCG
AATTCTGTCCTTTTTGTGTGTCTCGTTAAGTTCGCACTCTCAACCTGGTACCGATTTTATTCAAATAGAACGCTCTCGGGGGGGGTACTATAAAAGACGG
AGGGTTTCTTTTTGGCGGCAATCTGCGCATGCCCGGGTGCACTTGAGCGCCAGAAAAGGGAAACACACAAGGGGCGGCGACACCATGGCGGAGGTGAGCG
AATGCGCCTTGTATATGCAGCAGACGCCTGTCTATATACATGTGACTACTAAGCAGCTTACTAACGTACGTCTCTTTATATTGAACGAACCGTTTGCCCC
ACATGCAGAAGAAGAAGCAGGCGTCCATCGCTGCGTTTTTCTCGCCGCAATCGCGAAGCAGCAAGCCCGCGGCGAAGGCACAGCCCGTGGAAGCGGCTGC
CACAGCAGCAAGCTCTAAGAAAGTGAAGAGTGCGAGTAAATTATCAGAAAAAGACAACAATGCAGTAGGAAGTGGTCCGCGGACACCACCTGCCAGTGCG
ACGAAACGACTGCGAGTGGAGGAGAGCGCTGCGCCGGATAGCCCTGAGCTGACACCAGTGGTGCAAACACCTCCACCGACTCAACAGCTAGGTGATGTGG
ACAGAGATTATGAGATGACACCAGCGAAGGCGTCAGTGGAGGCGTCTGGAGGCGAACAAAATGTGGCGAAAAAGCCCACTGTTAGCGATTTGTTCACGAC
ACCACCGCCTACGAAGCGCGTAAAGCATTCTGTGCAACCGTCAGAGGAGAAGAAAGCGGCGGATGCTATTGATGTTTCGTTTGCTACTGAAGAAGATGCG
GATCAAGACGCCAACAACAATGATGACGACGACCATGACGATGATGATGATGATGATGACGATGATGATGACGACTCACCTAGCGCCGCCGGACCTCATG
CAGTAGGACCACATGCAGCAGCAAGTAAGAAGCTGAAGCAACCTCGCACGAAAAAGCAGACAAAAGCGACTCTTGCTGCCGCTGTAACTTCAGCTGGTGC
TGCTGGACCGAGCAAGACTAAAGGAAAGACTGCGGCGAGAACACCCAAGCCGAAAGCAAGTGACAAAGCGAAGCCAAAAACCGATAAGGCGAGCGCAGCC
ACGCCGAAAGTAAAAGAAAAGAAACCAGCAAAGGCTGGAAATGAAAAAGTGACAGCTGCAGCAGATGCTGCCCAGGTAGAACAAAAGCAGCCTGCTGTGG
TGTTGGATCCAGTTGTGAAAGCAAGAATTGATACGTATCAACAGAAGATCGACGAGCTCACTCGACAATGCGCACATTTGCTCAGCGCACCCACTGCTAG
CGATGGAATTTTACAAGAAATCTACGGCGTTGCCATTGATCTTGGACTCGAGCTCAACGGGTACCAAGATATTGTTTCTAAAGCAGTTGCGGAGTTGAAT
CAGCAGTTATCTCATCAATCAACCACATCAGATGGTTTAGAGGCTGTTGCTGAATTCTCTGCAGACATCAAGACGTTCATTGCGCGAAGTATCCAGGGCC
GCACTGCAAGTTTGTCTTCGCTATCGCTCGAGCTGCTGAAGACCTTGGAGCAGTTCGCCAAGACTGGGTTGAATGGTGCTGGGTTTGACGCCAAAGTGAA
AGATCGTGTATTGATGATGCTGGAGATGGAGATCAAAATGCTTGCCCAACGCACAAATTACGGAGTTCGTCCAGCAAAGGCAAATCTGTTTGAAGATACA
AGTGTCGATGCGCTTTGGATTTGGGAGATCGGCATCCTAGAGAAGTACTTTGTAGATGATTCCCAAAAAACAATCAAACGGATGCGAAAAAATCGCAAGC
GTCTTGGGCAGCAGCTAAAATCACTGGCGCGTGTGGTGCAACTACTCCATCAGGTACCGGTGGACGAGGTCAAAGTGAGTGCCGAAGAAGCAAAAATTGG
GAAATTTGTCACGGCGATCGAAAGTGAGACTCAAAAAGCTAAAGATCGAGAGCGGAAAGAGCAAGACAAAGCGCAACTAGCAGAGCAAAAAAGACTGCAC
GAGCTGGAGAAAGAGCAAGCGAAGCAAGAGGAAAAGAGGAAGCGAGAGGAAGATGAAGAGGCTGAAAAGATCTTGGCGAACAAGCGAAAAAAGTCGCTGG
TCTTGTACTTTAGATCTATTGATAAATCTGCTGACAGTGCTGCCCCCGTTTCTTCGACGACTGGTTCCACTTCAAATGCTGCTGGTCAAAGTGACGAAGT
AGAGATCATTTCAAGGCACGACGAGACCATGGCGCGCATGGATTCCGCGATTGATTTTTTGGTAGGAGGAGAGAAGACAAAGTCACAGGCAGAGCTTGAT
ACAACGATGAAATCTGCCCTTCGAGCACTGCTCTTGCCAAATGGATCCAAGAAACTCCGAGTGACAGCATCTTCCGGACATTGGAGTGGGAAGCGCCGGC
GAGATCCTGCTTTAGGTTTGATGAAGATGCTCCAGTTTCACGAGAACTATCGTCCTGCGTATTACGGCACTTTCAGCACCAAGAGCAAGGTTTTCCATGG
TGGCCGTCGCCCTTTTGCACAGTATAGTAAATTCGATTACTCTGTGGACAGTGAAGAAGAATGGGAGGAAGAAGAGCCTGGGGAGAGTCTTTCCGATGCT
GATAGCGACATGGATGAGTCTGATGATGACTTGGACTACGGTGATCAATGGCTTGCGTACGAAGACGAAGTGGACTATATCGACGAAGGAATGAAGGACG
ATGACAGAGATGATGGCAAGTATTTGTCTTCGCCAGAGCGTAAAAAGAAGATACCACCGCAACTGGAACAGAAGAAGCGAGCTCGCGTGTCAGGAAAAAA
GAAAGGAGCAAAACCTGCGAAACTCGAGCCACAGATCGTTGGACCAAGTCGATGCCTGGAGATTTCGTGTGCGGAGCATTTCGGTGAGCACCAAGGTCAG
ATGTTGCAGCAACCTGCTTTTGAGTCAACTTTGCTGCGTAAAGCAAGAGAATACGAAGCGCTAAAAGAAGAACAAGAGCGCCAGCGACTTGTTCGAGAAG
AAAAAGAACGTGAACGTCTTCAAGTTGCCAACGAAAAACAAAAGCTGCTGCTAGATCAAGAAAAGAAGCAGCGTGATGAAAAGCAAAAGCAGCAAGATGC
TTCTCTTGCAGCTGAAGAACCTGTAGCCGAGAAACCCAGCGAAAGTACACCTGACCTTAAAACGCCACAGAAGCGTAAGCTAAGTGCCGAGAACACGAAG
GCAAACCCTGCAACTGCATCGAATTCAACGACGCCAGTCCAACCTGTGAAGGCCAGTATCACTGCGTGGCTGAAAAAACCTGCAGTAGTGGATCAAAGCA
AGCAAGATAGTGGTGAGTAAAAGCGCCAAGCTACTAGGACAGTCAAGTTAACGAGAATGTGAATACGACAGGTAATGATGTTTTATATTTGGGTTGTTCA
ATGGGAGTTGCTCACTTGTTTTGACATAGCAGTATTATGACCAATTCAGGTCGACTAGCGAAAGGTACAATCTGCATATTTATATTTTGACAATGGAGTT
GACGAACATAGTTTTTGTTCCTAGGTGTTGGGGTGCTTTCGCAATCGGAGACCTTCACTGCTGTCCACTTTCTTGGCGAGAATCCGAGCGTTTTTCATGA
AGGCCACACCAAGCGCAGCATTTTGATTGTTTTCGAAGGATTTGCTGTTTGCCATAGCCCTGGCTTGACGCATGAAGTGCTCCAGCTCTGCAGGCGGGTT
GTCAACATTCAGCTGATGTGCTTTGTTGACAAAAATCGCAGCTTGACTAGACGGTGTCGCCGCACGCTTCTTCGCTATATCCAGAAACTTTTGCTCCGCG
TCGGTGAAACTCACGGCAACTTCGCTCACGTTTGTTGATGCCATCAATGCTTGATGCATTGCCCAGTGTCCCTGGTCTTCTTTCTGCTTCCGGTCTGCCT
GTCGTCGTAACACCAATAATACCGCAGACATTGTGACTGCCGCGATGGTGAGCCACCCAATGTAGATGAGGCTCATCGAGGACATCACTCCCTTTCGGAT
TTGATAGATCGCGCACATTGACGACCAGCACGAAGCAGCGTAGATACCTGATTTTATGAGCTTGATGAACCAGAGTGAGGAGCTCTTCATGCAGCTCATG
AGAAGTAACAGAACCCCGTTTCCAGCCAGCCCGATACAGGCAAGAACAAGCGAGTTGAACGTGAAAAATGCCTTGGCCGTCGCTGTCAGTGCCTTTACGA
GCTGACTGAACAGCACAATCACAGCGGCATACTTGATGTCGAGTTTCTCCTGTTGAAAGAGTACTTGGTTCATGCCGTGAGATAGCAAGCCTACTGGCAA
GAAGAATGTGATACCCCAGACGCCGAGGAAAGCGTATTTTTGGTGTTCTTGGCTCCAGCAAGTAATCGACTGGTGACTCAGCAGAAACGGCGGATCGTCC
ATGTCACTGTTGATGCACTTGTCGAACAGTTCACCGTACTTGCCTTTGCAGTCAATGCAGGACAAAAACGAAAAGAAGGTCGTGATGGTACTCATGTACA
AGAACCCATTCAAGAGCAACGGCAGGTCCTTGGTAAAGAGGTGATTGAGCTTCGGACTGGATTCTTGGAATTTGTTTGCAGATTTGAGCATGAGGAACCA
TACAACAAGCGCCAAAATGTAGAGTGCGGCTTTCAGCTCAATCTGCGCGATACCAATTTGGGTGATCCCGAGGGATCCCAACCACTGCATGAGTTTCGGG
ATTTGATCCGACTTGTTCCACTCAATTGTGGGGTCAAAACTTAGTGAATTCAGCTGCACCAGTTCCACTATGATTGAGATCACCGCGAACACATTATCGT
AATATTTGGCGGCTGGAGAAAAGCGAATTCGATCTCTCTCCTGAAGAACGAAGTGCTCTACAGTCAAAGATGAAATTTAGTATGAGGGTGAACGTTCAAG
ACTCGAGAAATGATAAAGGTCAACGAATACGCACTTACTTCTCGCAATACTCACGATGGATGCAGTCGAGAGGACGAACACCAGTGCGACATGCCCGTAA
ACAACCCGCATCATGAACTTATTTCGCTGCCGCTCATCGTCAACATGCACAAGCGGAAAAAAAAAGCAATCACGATCGAGACTAGAGTACCTCCAAGCAA
GTACACTGGCATTTGCCAGAGTCGCAGACCTAGGTTTCCGCTTTCTGGCATCCACACGCGGACGAGTTCGGCGCAAGCTTTTCTTGTATGGAATGAGAGA
AAGTACTCGTCTCGCTCGTGACGACTGTGAAACGCCTTCAACAGTACATCGTTCTTCAAGTCCGCAGCCAGCTCGTCTTGTCTCCAAAACACCAACACGA
GAAAGATCAGCTGAGCCTGTTTCCCAAGTCGTCTGATAAACTGTGGCGTTGCTGACGAAAAAACATAGCTGAACCCTGAAGTACCCGTCAGCTCTTTACG
GCTGTCAAGAGTTTGACGCAGCCTTTCAACTGCAAGTTCTTCGGTGAATGGGTCGACGCACGAGATTTTGTCACAAGTGGCGAGCGTCTGAGCGCTGAAC
AGTTCATCTGGGAATGAAGCTTGCAAGCGATACGGGCTCATTGATGTCGTGTTTGCACTCTCTAGCGTTGCTGCAATCTTGAGCTTTAGTCGTTCGGAAC
TCAAGTTGCTGAGCAGAGTTTGTCTTCTGCCGCGCGTCTTTGCTTTTTGGATGAAAGACTTTGAAGTCTTGTGGTGGGTCTTCGCTTCTTCTGGGTGATA
ATTCTCATCAGATACTTGTATGGTGCCCTCGACGAGCGAGCTCTTTCGATATGCTTCTTCTTCGTCTTCCAATCGATACTTGCTCAAAATGTCTTCCTGC
TTCTTTGAGTCACTGGTCAAAAAATCTCTGACAAGAAAATACAAGTGGAAAAGACGTATTCGCTGAATTGGGCGTATGAGCAATGGCCACAATCTCAGCT
CAAAGGGAATCTTTTCCACCAGGTGAAGTTGAATCCCGGCCTCGACTTTGTCTAAGTGCTTCTGCAGTTGGTAAAATACGGCCTTAATTTGGTCCGAGTT
CAGCTTTTGCAATTGCGCTTCTAGCTGGATGACAGACAGCTTTTCAATCGTATCAGGCGGTATCTCAAATATTCCGGAAAGCAACTTCAACACACGTTCG
CGGACACCAGCGATGGTCATGGTTTGCTTTATCTTCTTTGCGCGCAACGACGTGTAGCCAAAGTGATCAAGAAGTGACTCCATCGAGCAGAATGGGAAAT
ATGATCTGTCCACGAGCGCATTCTTGGCTGTTGTGGCGGGATCCATTTGCTCTGCTTGGTTTGGCTCGGTGCTGTTGTCTTCAGGAGCATCGTACGCTGA
AGATGATTCATCGCTTGAGAACAAGCTCTTCGCTATTGACGCAAGCAAAGCCTGCAAGTGTTTAGCTTGCTTCATGAAAAATGGCCCTGGGTTCAAGAGG
AACGCGATGAGGTTTGTGACACGACGCTTGAGTTTTGCCCAGAACCCTTCGGTGGATTCAGCAGTTCCCGTCATGAACTCACAAAGCGAGGCTGACCCCA
TAACTCGTTTCCATATGTAGTCCATAGCCACGAGCGTTCGCGCAAGCCGTTCCTGTGCCACTTTGGAATTCAAGACGTACACAAGAGCTGTACTAACCGC
GGTTTCCATCAGGCGCAAGCGCTCGCAGATTTTCTTCGCTTCTTCGGCTACTCCACCTCCATTTCCGGCCACACCCTTCAGCTCGTTTTTGTTCGCGATG
CGTTTTAGTATCTTGTTCAAGTTCTTCAAGAAGAGGAGGACAGTGTGCTTTTTCGACTGAACCTGCTCCATTTTTTGCAAAAAGGACGGTAACTCTGTCA
TCAGCGCCTGAAGTTGGTGAAGCTGCCCGCTGTAGTAGTTGAAATCAAGCTCGTGCAATGCGCAGCATACAAGACCACAGAGTTCTTCCAAGTGCCTGAG
CCAGCTTTGAATCACGGTGATGCTTTTTACATCCGCATGATGCCTTGCTCGAGCCCATTCAAGTCGACCGTCATTACTTTCTGTCTGTGTAAGCGCGAGC
ACGTCCAAAAAGAAATCAAATGCCAGTGAAAGTACCAAGTGACATGCCACCAGCACGCGACCATTTCGATCAGAGGTATTCATGGCATGTGTTAGATGCC
GCTTGCGATTCGCCGTCAAGGTTGTCACAAGTTCATCATGCGCCTCAGCAAACCCCAGGAGCTTTCTGAGCTCTGTGAGCATAGTTTCGTGATCTGATTC
AGCTACATCTACGTCGTTGTCATGGTCTTCGTGGGTTGCTGCGTTCAAGTCACTTTGCGACCGTGAAGCTTTGATTGTGGAATCGAGAAAATCTGGCACC
TGACCGATCAAGAATTCCTGATCATATCGGAGAAATGCAGTGCGGTACTGAGATGGAGTCACTCCAGTGCGAACACCAGCGCATACTCCAGCGTAATACG
TTCGTCGAATTACGTTCAAGCCGCTCTCAAAGCCCCATTTCGTCAGCTCAATGCTCTTTTTTATCCCAGGAATAAAGTGATCCCGGAGCTCATTGATGCC
TGAGTGTCCACAAGTCTCGCGGTAAAGGAGCTCCAGCAAGGTGCGTTCGAACGCAACTCGGTGAGGGTGCTTTTCCACAAGGGAAACAAAGACTGTAGCT
GCTAGCCGATCGAAGCTGTCAAAATTGCCACGGCTAGTCGATCTGTTGCGCTTACGAGCGCTTGATGCGTGCCCAAGAAATCGCAAGAGGATTTCTATCA
CGGATAGCGATGATTGCAAACTGGCTGAAGGACGGACTTGTGCTGGCATCAAAAGGTTCAGCAAATCCATATCGTTTTGGTTGGCAGGATCAATTATGGG
TGGCTGGACGACGACATCACAAAGAAATGACGTGGCAAGAACCAGGTTTTCCGCCGCCTCGACCAAGAAAGGATGGCTCAAGTAGTTTCGGAAGACAAGA
AATGCAATTCGGCCAAAAAAGACCATCCCTCCGTGGCTCATGAATTTTGCGCGCGATGTTGAGCAACGACAGATTTTTGCAATAACCCGCGTAGCATATT
TCAGCATTTCCGCAGTTGAATCCAGAAGCTCGTCACCGGGCTTCACCGAGTTTACCAGATCTAGAAGCAGTTGCAGTGCATGCTTGCGTGCAAACACTTC
ACAATGCACCATGTTGATGCGAACGACAGTTGCAACGAGGAAGAAAAAGCTGGCACATGCACTCCGCACTGGAAACGTGTGAGCGCAGAGGAAAAGAAGG
ACGTCGGTATTTTCGAAAAAGAACATATTGAGATAGTTTTCGGTGAACTCAGGGACTTCAATTGCTGCGACCCACTCCATGAGAGCTGTGAGGAAGTTCT
GGTGATTTTTGTCACGAAATCGAGCGTCTTTCCTTTGCACATGTGAAGACTCGGGAGCCTTCACATCGACCACAAAGCCATATTTTCGCATTCCTTGGAT
AAGATAGATCACAGGAATCATACTGGTCTTGAAGAAAGAAACTCCAGGTTTACTCCAGAACCACGACGACAATGTGTCTAGACACGACAAATCAACTATT
TCAATTGGATCATGTCGTCGAGATTGCGTCTGCTGCTTCATTTCCGATGCAAAAGACCCGAGTGCCGATAGAACGTGATCCCATATCTTCAGCAATGGAT
CGCAGAAAATTCGATGGTTCTTGGAGAGCTCGGCAACAATGTGCGTTGCCTCCTCAAGGACGAATAGATCAATACCTTCGTGACGCAGTAGTCGCCCGAG
TGGCCCGAGATCTTCGCTTGGTTCGTCTATGACTTGGTCCGAGAAGTTCACGATTACACGCCCGCTGTCAATTTGCATGGTCATTGACGTCTGCGCCGTA
TTGGCTGTGCTGCTATGGAGAGGCTGGACTTCGGTGGCATTGAGGAAATGCGTTGCGGATTGCTTGGCTTTACAAGGTACCTGACTCGTTCGACCAAACC
ATCGCAAGACAACTTTGCAACACACTGCATAGTCTGCATCATCGACGATCATCGACTGGGAAACGTGCTCATTGACAGACCGGATATGAGACGTCCATTG
AAATTCGCGGTGCACTTCTTGCTTGCTGCGAAAGACTTTGACGTGCAGTTTCACGCGGATGGGGAAATCGAAGCCACTCTCGCTGCCCAGGTTGAACCTC
ATTTTTTTGGGGTGGAAAGAGAGCAGGATGTCGACTTTGCGAGCATGTACTACCTTTGGTGATATGTATTTGGCAATGCTCGTCTTTCGTCCGTATTGCT
TTCCGCGAAACAACAACCGAGCAAGTTGTTCTTGGAAAGTAGGACCGAACGTAAAAACGTTCTGGCGCCGTTGTCCAACGGATTTGGTGGCAAGATTTTT
GAGTATTCCGATCGCAAATGGTTGAAGGTTCTCAAGCCTCGGATTCTCAAGCCACGAGCAAACACGGAGGAGAAGTGTGTGATGAGAAACAAAAGATCCT
TGACATATGGATACGACGTGATATCATACACCAAGCGCACTGCAGCGATTTGCTCCGGAGAAGATTTGGTAGTCTCGATGATCACCAAAAGACGAATCAC
GGGGAGCTCCTGAGCAAAGATCTCGGCCGAGTACTGGGTGTAATCAAACGAGCACATTAGGTGGAGCAACGAAAGTGCTTTGCATCGGATCAAATCGTTC
TCCACAACAACAACCTGCTGTTCAGCAACTACATGCCGTTTGCAGAACGCCAGCAGCTCCGAGCACAGTCGAAAATGCTGCTCTTTTTCTTCCGGGATTG
GAGCCTCACCCGTCATGTCATACACCACTGGGAAATAGTTTGCAAGAAGATACAGCAAGATGTCCAAGATGCTGACAAGATGCTGCTCACTGATTGATCC
ACTGGGGTACTTCCACTGTGTTCTCCGTTCACCATTGTTGATTGTTACCACACGGTCAGCAATCATGGCCGTTTTTGAGAGTAGGTGAGGATTGTTCGCA
TAAAACTGAACCCAGGCAGTCAAGATTAGGTAGCAAGATGTTAGTCCAGACTCGCGAGGTTCCACGTCGAACACGTCGTGCTCATTCAAAGTGGCAAAGT
AGGCGAGCCGCCGGTACAGATTTGTAGACGCCAAGCCAGATCTGCAGACATATCTTGAGAGCTGATTGTTGCTTTCCTGCTCTTCCGCGGTGCCGTGACA
TTGCTGTGAGGGTGTACATGCAAACGATTTTGATGCCTCTGTGATGATCCTCGCGGCATCACGTGAAACCATCCAATCTGAGCAGCCAAGAGCAGCAAAT
AGTTCGCGAAGGATGCCAACTTCCTGTTGAAGCGACTCGGCAAAGTGTTTGTTTGCCATACACAGGCGTAATATTTTCAGTGCCCATTTGCACGCTTCAA
GGGCTGGATATGAGTCAAACTGGACTGGGAGAAAATTGATCGGTTGTTGCGACTTCAGCGCTTCACGAGAGAGCCGAAGAACCAAGTAATGCGATGTCCC
CACAGTTTGCTTGAGAGCCAACTGAAGCAACTCGAGCATGGAAATGGAACACCCACGCCTACATTCTAGCACTGGATCAGCTCCAAGCTCGGACAGGCAA
ATTTTGTACAGCACACACAACGAGTGTTCCAGCGCGATCGAATCGTCGTGGCACATTTGCACCATATCTGTGAGACCTCGTAAGGAACTTATCCTGGTTG
CGCGATCGGTTGTGGAGATATTCCCACGATACAGCGCACACGCCTTCCTTAACCGAGGCAGCAGGTGGAAGTGACACGCCAACGCGCGGAGGAGTTCAAT
GGCGTCGTACTTGATGGGATGGAATTCTGGAATCAACGCTATTGTCCGCACGCAGTGAGTGCCGAGCGCACGGAAGAGTGCGATGTCTTTGCTCAAGAGT
TCCACTGGATACTGCTGAACCTGAAGGATCCTCGTGAATAATCCTAGCAACGACTCGTTTGTCGAGTTTAGAAGATTCTCTGGCGCACAGCTATCAGTTA
GTCTCTCCCACTCGAAAAATCCCAGCAAAGACTCGCTTTTTGGCTCTGGAAGGTTCGACGACGTACTGCAACCAGTTAATATTTCCCACAGAAACTGGTA
CAGAAGTTTGCTTTCCATGATTCTCTTCGAGAAATCGAGATCAACACACGTGTATCGAAGGATCTGGCACCAGAGCGCTGTGCACTCGTGTTCATCTGCA
AACGCGGATGCTGATGTGGAGACACTCCACCAAATTGAATCGACGACGTCAAACTGTGTCGCTTTGATAACCCAATGGATGTTTGTCTCATTTGCGAAAA
GTTCATCCGCTGTCCGAGCAGATTCATCTGCCTCCAAAAGTATGAGTAACGTGCTTTGGGCGGCGAGACGTTCTGCATTGAATTGATTTACACTGAGAAC
TCGAAGGAGCTGGTTGCAAAGCGATATGAAGCGATGCGCTGGGCCCCACAGTTTGCTGTGATCGGGGATTGTATTTTCTCGCAAAGCTTCGAGCAAAAGC
TCGTTCAGATCCAAGGTGGTACCATCGCAACCATGATCGACGTAGAATGCGCTGGCCATGTAAAGCGAGATTGAGTACTGAACACAGCAGTCACGCTGAC
GTGATGATAAAGGGACAATACGGCCAAGCTGGAGAAGATTCGATACAATCAATCCAAGTTCATGGTTGATATGTGTCGACAACTTCGGAGAAGTCAAGTC
TTCTGTAGGCATCCAAGTTAACCTCGAGTCAGAATCTAGTGTTCGATTCGCTGACGGCTCTGAAATTTGGTTGTCGCCTACGCGGGATAACAATACGAGT
TTGGTAGGCTCGGTGGTCTTGACTGACTTGTCTTCCAGAAAGCGGTACCATTTTGTGCAGATCTTTTTGAGTACCGACAGAGCGTCAGATAAACGTGAGC
GGTTGTCGTCAATCATCAAGACCACCCGCAGCGCTGCATGAGCCACAATTCCCTCATCTTGCGATCCGTTCTCTAGGAAGAAGAGCACGTTCCCAATTAT
GGTATTCCAAATGCTCGCGTCATTGTGTCCATAGAAGCAGTGAGTCTGGGGTTCAGTGATCACGGCGGGCAAAAGATCGAGATACGCAATCCGCTCATTC
CGAGGAATCGAACTCAGCGAACTATATCTCGACAAGATATAAGGAATTGACGAAGGTAAATGGGACGCCGATAGTTTCATTTTGACGCTCTTGGTGAGCA
TGCGAAGTCGCTCATGGTAGAGTGGGTCTTGAAACGTCAAGTTTGCAAAAACGCCCTGCACAAGGTTTTCATCCTCGAAAAACATATCGAGGACGAAATC
ATACGAACAGAAGGCACCAAGAGCAAGCACAGCTCTTTTTCGAGCGAGTAGGTTGTTGTCACGGAAAGATTTGCTGCTCGCAATATTCACCAATCGTTTC
AAAAGACCAAGGCCGCTGTTGCCCCACTCTTGAGCGCAGGTTTTAGCAAGCCAGTAATGAACCCCGTCGCTGTCATTGATGCAATCTAACGCTGCCGTCG
TAAAAGTGTGCTCGTCCGGATTCCGTGATTCTAACAGCAAGGCGCACAGTAGAGTCCACACATCACGAACGGCTGCTGGGTTTTCAATTTGTCCTTGTCT
GCACATTCGAAAGTGCAAGTGGTGCATCCGTGTGCATTCGAATGCAAGCTCATACTGCTGGCCAGGATTGCAGAGTTGTCTTCCAGAGGTCCTTACTTTG
ACTAATCGATCAAGACACCCCAATTTCCTTGCGTACTCGTGGGTACCGTGCGAATACTCAGTGATGGTGTTCAACGTTCGTATTGTGTCCGTGATCAACT
CGCCTCGAATATCGAGATTCTCTGAATGCGTGTGCTCCAAGCAGCTCAACAAGGTCTCAACGATGTCACACTTCTCATTTCGCCGCAACCCGTCAACTTC
GTCCCAGATAGACATGTGTTTGTGTCCATATTTTCTTAATGCCCGAATTGTCTACGCTCAAGAAAATGACAGTCTTAGGTTAGCAAAACACAGTGACGAG
GAACAGCAACATCAAAGAGAAATAGAGGCGAACCTGAAGACGCAGCGCAATGGTTGGAGATTCAAGCAACGGACAGCAGCGGAGAAGAAAAGCGTTCTGT
CGAGCAACTCGTCGGTACTCTTGGATCCCGGAGTGGTGTGATTCAGCACCATTCTCACCTATAGCGAACGTGCTCAAGATATTTTCAATCATACCCATCG
AGTCTAGTGTCAGCATACGTGAGAATGCCGATGCACCATTGAGCGATAATGACTGGATAGCTGGGACAAGTATGTTGCTTTGAAAAGTGCGGTCACAAGC
TGTGTGTCTGTTTTTGCCGAGCAGATTGCGAGCAATGTCAGGAGCAAGGTAGCGAAAGCATCGAATGTGTTGATGAAGTATCTTGAAATTTCGTTGCTCC
GCAATATTCGACAAGGATTCTTCCTGGTCCCATTCGATAGCTGAGTACAGACTCAATTCTGCTTGAACCGTCTGAGCACGTGTAAAAGTTTTCCCATAGA
CCCAGTCATGGGCAGGCAGCCTGATAAGAAGCAGGCGCAGAGCGCGGATAACCAAGTTCCCACAAATTTCAACCTTTGTGTTCATAAGCAGCCCAGCTAT
GAGGCCCAGCACGCAGACCATAGCGTTTGGACTTGCTGCAATAATTGCGATACGATCAGCAGCGAAATTGAGGAAACCAGCAATTTCGCTTTGACTGAGT
ACTTGAAGCATCGTCGGTTGACCCTCAAGGCTGCGCACAAAAATCAGCTGAAACACCCACAATAACCTCGTGGCGTACGTCAGACTGGACGCAGACACTT
GGCTTAAAGACAAGAAATGAAGAATCGCTGGTACAGAAAAAGCTTCGATGAACTCCACAGTTGCGTCGGACCTGGTCGCAATCAGCAATTGCTCTGAAAA
ATAGCACAGGAAACGCAATCGAATTCGAGCTTGGTTGTCGTCGACGAGAGTGTCACATGCTTCAAGCCACTGGAAGATCAGTTGAGTCACACTCAGTATC
TCTGGGTGAGACGATAGAACAAGGGCCATGCGTCGATCGAGACAGAGACAGGTAAGGAAGGCAAGACTACCGGTTTTCAGCTCCTCATCAAGGATTTGCA
AACTCGACTTCCCCATCTCTACCGTTGCAATGCTGTCATCTTGACTTCCGCTTAGAATCCAATGATAGCATGGCTCTGTGACTATTCTCGATTCCACCGG
ATCGTGCATATGTAAAATGAAGAGCTGCTCGCGCGAAGAAGGATCTCCCATCAACACCGCAAATAAGCGAAAGAAGTCGCGCAGGACTCGGCCAAGTGCA
AAATGGTCTCGGTCTCTGCGGAACCAGTCCGAGAGCTGGCTGAAAAAACTCACGAATATTCGAATGGTATCCTGGTCGACACTCTGCAGAAACTCTCGTT
GTGCATATTCATTAAAGTTTCGTAATGACAGCACAAGCGCGCGCCACACGAGCAGATGCCTGGCAGTCGGGGCATCGGGGAGGACGCGTAGAAATCCGAG
GGCGACCGCGACAAACCCTTTGTCGATGAACGCTTTTACGCCGTCATGAGAATGAGAAAGAGCTTGAACGCACAGCAAGAGCGCTTCCACCTCCGCGCTC
GACTCGATAGCAGCTGCAGTGGACTGCAGAACCTCGATGAGCCGCATAATGTATCCGACTAAATTTGTCTTTTGGTGGTCCCTGCTCTCAAGCTGCACCA
TCGCGGCTTGTGCAATGGCGCAGTTTTGTGGAGAGTCAAGGCACAGCACACCAATGCAACGCAAAATGATCTACATGCAAGATACATCATGAATGACGTG
TGAGTATGGCGGCAACGTAAGAGCTTACATATCAGGAGAAGAAAAAAACAGCAACTACGTACAGGACGAATCGGCGCAAAGCGCGAAAGCAGCTGAATCA
GTAACGACAATATGGAGAATTCATGTTCGACAGAATTGCGGAATCGCAAGTCCAGCTCTTCATCAATGTCCGCGGCGCACACGACTTCAATGAAGCTGCA
GTAGACTTGAATCATCTGCCGCGCATCCTCTCTGGATTTGATCGGAGCAAACGCTAGCAACGCGTTGAAGTCAGCAGCGATGGTAAGGAAAGTGGGATCA
AAGGCTTTGATAAACACATATCCCGATGCCCAGATTTCTCCTCGTAACGTTGGATCCGAGCAGTAAAACGAAACAAGTTTCAGCAAACCCACACAGCGCT
CTGATGGTCTCAAAAGCACCAGTATCCGGGTAAAGTCCAGATGTAGTGAAAGCGCTCGACTGCGCTCCATCAAGAATGCTGGCTGGCGGTGTATCGCTTG
AACCAAATGCGTTGCAATGCACTCTGCTGCGCAAAATTTAGAGTCTGTGCCTTGCGCCAACACGGATTGGCATTGCTGCAGATACTCCAATGTCCAGATG
TCATGAATATTTTTCCAGATCACTGTCATGTTCTGGGTGACATGGTCCAGTAGCCGAAAAAATGTGCTCAGGACACAAGTGTTCGTTGCCCATTGGACAA
TAGAGAAGCGTTGAACCAAACTGAGGAAGAGACTGAGGTTGCTGGCCCATTTTGGACGATCGAGGTCTGTGCCACTACCATCGGCTTGAATCTCAATCGC
ACAGGCCCGTTTGCACAAGAGTTCGTCTTCAGCGAATCTGCACAAAACCTCCAGTGCAGACATGACCAGCTGAGGTGAAAGCCACGAAGTTGCAACCTCA
AAGACGATCTGAATAGCCCAAGTATTTGCCACAAATCGAATCGCAAACTCTCGAGAAGACATGCATTGAAGCAGGAGATCCAGTCCGGCCGTCTGCAACT
GCTTTCGTTCGAGGCTGCAGCGGGACGGTTTTGTCGTAAACAAGCCGAAAGCTTGAAGCTCATGAGAGCCGTCATCACCTCTCGTCGTTATGCTTCGGTA
GTGTTTGACTAGAAGTTGGAGATGGGATTCCCCAAGGCCAGCTCGAAGATCGTCGTAGGTCAGCGTGATGACAAACAGTTTTTCCTGATTGACGCGGGTT
TGGGATTGCAAGGCAGCTTCGCCTTTCAGACTCCCAGTGAGCCATTCTGGGAACCCGATTAGGCTTCCTCGGTGCAAGACACCTGTCAACGTTGCTTTAC
GCGGATATATCACGCGCATTTCATATTCGGCATCGTTGCCAACAAGCAGCATCAGCGGCATGTCCTGGTCACATTTGTAGCTGTCTAGTGAGACCAGTAT
TGGCGAACCCAGGCGGTACGTGAGGCACGCAAGTGCATCGCGGTCAAGGCCATCAAAGAGAGGGCAGTCGTGCAACAGAGACAGCACATCATTGAGTTTG
TTCTTGCTGTCCTTGTCCAACCCAGCTTGTTGGCGATGCTGCTTCATGAAGGTGACTCGACGAATCGACTCGGCACGGTCCTCAATGAGAAAGCGACACA
CTCGAGAAAGCAATCCCGTCGACGCGTGAGTGAGGCGCGAATGCCTAAAACACTGTTCGTCTCGAGTAAGAAATTGGACGATTCGATTGCTGATAGTTTC
TCGCGTTCTAGGCGTTGTACACCGCTCGTACGCATCTTTTTGGATTTTGTAGAGCATCAATGACTTATCTGCAGTCTTCTTCGCGACAATGTGCTGGAAT
TCCTCATCGATCCGCTTCAGCACTTCAAGCTCCTTCAGAGATAGGTTGGGTGAACGCGACGAGTGACTCCCAAACGTAATCATCCACTCTGGGATTCGCC
CAAACCGTCCATCCCCGGCTACGACCATCAACAATTCGTGTTCAACAAGATGGCTTCCAACAAAGCACATGGAGAGCTGGACCAACTCGGTGATCTTCAG
GTCTAAGAAAAACGGCAGCTGAATCAAGTGAGCCAGCTCGACCACTTCTTTAGGACGCAACTCTGGGGATACTTGAAGCTGGCAGCAACGCTCCTGGACA
CTGTTTACCATCCAATCTTCGACAACACACAGAGAAGACGAAAAGTATTCAATGCGGAAAAGCATGTCCCGTATTTTTGGCGATGCTGCGAGCTCGTAGA
GCAGTTGTAGAGCTGCAACCTGAACATGTGTCTTGAGGCTGTACACGTGCTGGACGACGCGATGCAAGATCCGCGGATCGAGTATGAACGATCGATGCAA
ATCTGGATGCAATTGAAGAACTCGTGAGCTCATTTCTAGAAGGCTAGATACAAACGTGTATCGAACATGCGGCAACAAAGAGCTTGTATACGCTCGATCC
ATCACAAGAAGCTCGAAAAGGAGCTGGACACGTTGACAGCCCACGAACCACAACAGTAGGACAGGCGATTGTGTCGAAAGAATGTTCAAGAGCCCGATCG
AGAACGCCAGAGCAGGCGCAGATGGAGCACGAGGATCGAGCATGGTGGCACTGTTCCCCGTTTCTTGGCCTTTCAACTTTGTGACGCTCACTTTGATTAG
CAGGTACTCCAACTGCACACCAGTCAGAAGCCGGTGGAATGAAGGGCTGATCCACAAAGCGTTGTTCTCCTCACTATACGTGAGCTCACCTCGGAAGTAC
TGAGCGACTCGCTCAATAGCCTCTGGACGCTGTTTGCAAAGAATGTAGAGAATCTCATAGGCGACGCCGAATGTTCCTGGACTTGCGAGGAAATCTTCGA
CAACACAAACAATATCTTCGATAAAGCCAGGCAAGTCAAACAGTTGCGGCGCGACTTCAATGACACTGACCGAAAACGCAAGAAACTGTGCGCGTCGCTC
GTACGTCATCGCAGAGATGGAGATGCCAGTTCGCGACTTCCATCGCGATAAAACAACGACGATCTTTTCCAGCGACGGCAGTCGTTCATTGAGGCTAGAC
ATTTTGGAGTTCGCAGAATTCTGACGCAGGCTCCTCCGCCACAGTTTGCGCAGGAACTGCCACATGTGCGCAGATCCGTGAAAGCTCATGTCGCCTGAGT
AGGCGGAGTTCCGGAAAGATGCAGGCAGCACGTATTGTAAAGGGCGGCGTTCAGAAGTTGGCGGCAATGGATCCTTGTTCAGGATTGTATCTGCAACACC
GCACCCGCCACCATCATCAGTGCGTTTCGCACACTCCACCTTCATGTTAGGGAGACGAAGATGAAGATCCACGAGTACTCGAAGTAGCTCTTCGAGGATC
GGCGGCTGAAGCAGAGAACATGCAATGCCGAGCTCGTCCTCCAGCAGAGTCTTGTTGTCGACTTCTTCACCCTTGGAGTCCTTGACAAATCGTTTCCAGC
TAGGCAACAGTGCATCCTGTAAACGTTCTGCCGTTGCCTTCGACACAGTTGAGCTTGCTGGTGGCATCGGTTGAGCAAGCTTCCGAGAAGCAGCTTTCCC
ATCTGACGATGTTTTCGAGTGGACCGGTTTGGCTAGCTCTTCGAAATACAGAGCATTGGCGAGCACGTCTGAAGCGGCAAGTGCTATCTCTTCGTCGTCC
GCGGTGAGTAGTTCGACCAACGCACGCAAGTTTACCTCGTCCGCGACTCGACTTTGCATTCCAGGCGTAAAGTGGCAGAAGTTCCGAGAGAGCACCATCA
AGTTTGCCAGCGAGATCAAATCAGAACATAGTTCTGGGATGTGTGCCAGCAGTGCCGCCGTTTTCTCTTGGAAGAGTGGTCGGATGACGACCTGCCGATA
CTCTGCCAACCGAGCGAGCGCAAACAAAGCTGTGCGTTGCAGTTCCAGTGCTTCAATTGAAGCCACTCTGCCGCAAATAGCAGAAAAAACATCAAGGTCA
ACAACAATGTTTTTTGTGTTGAAGCGAGGTACATCAACGCAAACTTACGCTTGGAAGATCGAGACGCGAGAAAATAGTGAGAGGATAAATTCACTCTGGG
ATGACACAAAGAGAGCGACAGCTTTTACCGTTTTGGACATTTTTGTAAGAAA