Description :
From Genome Similarity Track
Location :
Scaffold_49:230169- 231399
Sequence
1230 bases(100 bases per row)
GTACTCAGGGCGCTCCACCACCGGTCCCTCCGGGGTCTCGGGCGGTTTCGCCTCCGCGGATCCAGCGTCCGTCATGGCCTGCAGCGCGAGGTTCTGCCAC
TCCATGTAGCGGCGGGATCCGACGGACACGTAGCCTTGGATCCGCGGGAATCGATCTCCGGCCAGCCACACCCCAACTTGGTGGTTCTGGCGCAACGCCA
GTTCTTTCTCTCCGATATTCATGATCTGAAGATACCGCACTTTGCCTGGACCCTTGGTCACCGTTGGTACCCAACGATCCCCTCGAGTAACCCGCAGCTT
GTCGTGTTCCGATCCTCGCAGACGCATGGGCAACTCTGCGGACTCTCCGATCCCAAGCTGGAGATAGCGATCCAGCTTTACCGACTGCGCTTTGTGAACG
GCGTCCGCTGAGCTGGATCTGGACTTCGTCAGGCAGGCAGAGAGTCCCATCAGCTAGATCCAGTCGGATCCCGGTTGGGACCATATAGTCCATACCGAGA
ATCGCTTCTTGGCCAGACAGATCTCCTACCCAAATGTCGAAGAAATACACCAGGTATCCACCCAAGGTGATCTTGATCCGCGTTCTCCCTTCCGTCGTAT
ACACGTTGTCTCCGATACCAGCGCATTCTTGGCTCTGACTCCTGTCGATGTAGCACCCAACCTTACGAGCAAAGGCGGTGTCCACGATGGACACCTCGGC
ACCGGTATCTAGGAGTAAGATAGCCTTCTCATTGTTGATCTTGCCGTGGATCTTGGCCTGCCGGAACCACTTGCCTGGCGAATGTTGCTTCCAGTACGCT
CGAGATTCTCCAGGTAGGAAATACGAGGACTCTTGATCTACGATCCGCCGGCTTGCCGCGACACGTCGGGACCTGGATCCCGAGGTGTCTTCGCCTTCCG
TTGGTTTGAACCACTGCTCTGGATCCTGCTGCTTCCAATAGCCTTGACGAGCTTCTGGATCCAGGTCAAGTTCCACTGTCGCATCGGATCTGGAGTAGTC
GTCGGCTTGCCGAAGACGTGAGATCACAGCAGTACGTTTCCCATGAAGATCACATGTATTACGGCGTTGATCTTGTCGTTTGCTAACTGGATCTGTCGAT
GTCTTGTTCACAAATGCATAGATGCAATACCTAGAACGCTCGACTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCCTTTCCGCCATTTC
TGGCAGCATCCCCGCATGCTTGGCTGGATT